ID: 1033705445

View in Genome Browser
Species Human (GRCh38)
Location 7:143881951-143881973
Sequence GAGGCACGCAGATCAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033705445_1033705450 15 Left 1033705445 7:143881951-143881973 CCAGCTGTTGATCTGCGTGCCTC 0: 1
1: 0
2: 1
3: 5
4: 169
Right 1033705450 7:143881989-143882011 AAATGCACAGTGTGTGAGAAGGG 0: 1
1: 0
2: 3
3: 30
4: 310
1033705445_1033705449 14 Left 1033705445 7:143881951-143881973 CCAGCTGTTGATCTGCGTGCCTC 0: 1
1: 0
2: 1
3: 5
4: 169
Right 1033705449 7:143881988-143882010 CAAATGCACAGTGTGTGAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033705445 Original CRISPR GAGGCACGCAGATCAACAGC TGG (reversed) Intronic
901060174 1:6468222-6468244 GGGGCGGGCAGCTCAACAGCTGG + Exonic
901216041 1:7555932-7555954 GAGGCTAGCAGATCAGCAGGCGG + Intronic
901867539 1:12116915-12116937 GAGGCAGGCAGATGAAGAGCGGG + Intronic
902042101 1:13500017-13500039 GAGGCAGGCAGATCACCTGAGGG + Intronic
902317992 1:15638117-15638139 GAGGCAGTAAGATGAACAGCTGG - Intronic
903132201 1:21287292-21287314 GAGGCAGGCAGATCACCTGAGGG + Intronic
903251878 1:22060108-22060130 GAGGCAGGCAGATCACCTGAGGG + Intronic
903340527 1:22651494-22651516 GAGGCAGGCAGATCAACTTGAGG + Intergenic
904354005 1:29926808-29926830 GAGGCACACAGGCCAAAAGCTGG + Intergenic
905762180 1:40568782-40568804 GAGGCAGGCAGATCATGATCAGG - Intergenic
907446485 1:54511236-54511258 GAAGCACACAGGTCCACAGCAGG - Intergenic
908822955 1:68106490-68106512 GAGCCCCACAGAGCAACAGCTGG + Intronic
909562648 1:77023486-77023508 GAGGCAGGCAGAGCAACTGGAGG + Intronic
911679849 1:100702708-100702730 GAGGCAGGCAGATCACGAGGAGG + Intergenic
914842285 1:151258396-151258418 AAGGCAGTCACATCAACAGCAGG - Intronic
918434097 1:184493554-184493576 GAGGCATGCATATCTATAGCTGG - Intronic
919707356 1:200690200-200690222 GAGGCAGGCAGACCCATAGCTGG + Intergenic
919747475 1:201017625-201017647 GAGGAATGCAGAGCAACAGAAGG + Intronic
920298294 1:204973327-204973349 GGGACACCCAGATCAGCAGCAGG + Exonic
920725299 1:208429269-208429291 TAAGCACGGAGATCTACAGCCGG - Intergenic
921091143 1:211844630-211844652 GAGGCAGGCAGATCACCTGGAGG + Intergenic
924240180 1:242032805-242032827 GAGGCAGGCAGATCAACCTGAGG + Intergenic
1062768769 10:83889-83911 GAGTCACCGAGATCAAGAGCCGG - Intergenic
1069442112 10:68438286-68438308 GAGGCAGGCAGATCATCTGAGGG + Intronic
1069472410 10:68704944-68704966 GAGGCAGGCAGATCACCAGAGGG - Intergenic
1069675060 10:70240489-70240511 GAGGCAGGCAGAACAGGAGCTGG + Intergenic
1070556445 10:77531575-77531597 GAGTCACGCACATGCACAGCCGG - Intronic
1073797249 10:107001693-107001715 GAGGCAGGCAGATCACCTGAGGG - Intronic
1076814813 10:132909530-132909552 GGGGCAGGCAGGTCAACACCTGG + Intronic
1078123747 11:8537673-8537695 AAGGCAGGCAGATCAAGACCAGG + Intronic
1078224661 11:9381019-9381041 GAGGCTTGCAGATCTACAGCTGG - Intergenic
1079208558 11:18439847-18439869 CAGGCACGCACAACCACAGCTGG - Intronic
1079507789 11:21173639-21173661 GAGGCAAGCACATGAACAGATGG + Intronic
1080561310 11:33465496-33465518 GAGACAGGCAGATCTACAGGAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085424377 11:76390914-76390936 GAGGCACACAGCACAACACCTGG + Intronic
1085424381 11:76390981-76391003 GAGGCACACAGCACAACACCTGG + Intronic
1085494624 11:76957134-76957156 GAGACAGGCAGATAAACAGAAGG - Intronic
1089633277 11:119796586-119796608 GGGGCACGCAGCACACCAGCTGG + Intergenic
1092374516 12:7944171-7944193 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1095420072 12:42016244-42016266 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1097687450 12:62704183-62704205 GAGGCATGCTTAACAACAGCAGG + Intronic
1101774949 12:107785180-107785202 GAGGCAGGCGGATCATGAGCAGG + Intergenic
1102164294 12:110794378-110794400 GAGGCAGGCAGATCACCTGTGGG + Intergenic
1103648806 12:122417064-122417086 GAGGCAGGCAGATCACCTGAGGG + Intronic
1107529417 13:41267721-41267743 GAGGCACACAGAACCACACCTGG - Intergenic
1114769236 14:25409894-25409916 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1115600069 14:34947619-34947641 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1115646743 14:35373422-35373444 GAGGCAGGCAGATCACGAGGTGG + Intergenic
1117899228 14:60515447-60515469 GAGTCACGCAGCCCAACAGTAGG - Intronic
1118562906 14:67106906-67106928 TAGGCACACAGATCAACATGGGG - Intronic
1119004594 14:70911999-70912021 GAGGCAGGCAGATCATCACGAGG + Intronic
1120030331 14:79633770-79633792 GAGGCAAGAAGAACATCAGCTGG - Intronic
1120630730 14:86886845-86886867 GAGGCAGGCGGATCACCAGGCGG - Intergenic
1121344490 14:93125293-93125315 GAGGCAGGCAGATCATCTGAGGG + Intergenic
1123221916 14:106865473-106865495 GAGGCACGCAGGTCAGCCGGGGG - Intergenic
1127088888 15:55447540-55447562 GAGGCGGGCAGATCAGGAGCTGG + Intronic
1127675760 15:61237085-61237107 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1129518953 15:76173699-76173721 GAGGCAGGCAGATCACCTGAGGG + Intronic
1129798360 15:78395184-78395206 GAGGCTGGCAGACCCACAGCAGG + Intergenic
1129882200 15:79014681-79014703 GAGGCAGGCAGATCACGAGATGG + Intronic
1131025505 15:89138007-89138029 GAAGCCAGCAGGTCAACAGCAGG - Intronic
1131403810 15:92147198-92147220 GAGGCCTGCAGATGAACACCAGG - Intronic
1132457624 16:32913-32935 GAGTCACCGAGATCAAGAGCCGG - Intergenic
1134513047 16:14864157-14864179 AAGGCACGCAGAACAATAGGAGG + Intronic
1134971140 16:18532013-18532035 AAGGCACGCAGAACAATAGGAGG - Intronic
1135686746 16:24503844-24503866 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1136073496 16:27802979-27803001 GAGGCAGCCAGATCAACGGAGGG - Intronic
1136253450 16:29022825-29022847 GAGGCAGGCAGATCACTAGCGGG + Intergenic
1136559361 16:31029770-31029792 GAGGCAGGCAGATCACGAGGCGG + Intergenic
1138872762 16:60911894-60911916 GATGCACCCAGATTAGCAGCTGG + Intergenic
1139374644 16:66489287-66489309 GAGGCAGGGAGAGCAAGAGCTGG - Intronic
1142731158 17:1858694-1858716 GAGGCACGCAGATCACTTGAGGG - Intronic
1142862851 17:2773987-2774009 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1146453649 17:32993526-32993548 GAGGCAAGCCTTTCAACAGCGGG + Intronic
1147336600 17:39730169-39730191 GAGGCTCGCAGAACACCTGCTGG - Intronic
1147785538 17:42975904-42975926 GAGGCAGGCAGATCACAAGGTGG - Intronic
1148900910 17:50876358-50876380 CAGGCACGCACCACAACAGCTGG - Intergenic
1150328282 17:64274175-64274197 GAGGCACGCACCACCACAGCCGG - Intergenic
1152911435 17:83007446-83007468 GAGGGAAGCTGATCAAAAGCTGG + Intronic
1152961652 18:83722-83744 GAGTCACCGAGATCAAGAGCCGG - Intergenic
1153614403 18:6920972-6920994 GAGGCACCCAGATGGCCAGCTGG + Intergenic
1154057801 18:11028401-11028423 CAGGCACGCACATCCACACCTGG + Intronic
1154939166 18:21093720-21093742 GAGGCAGGCAGATCAAGACTTGG + Intronic
1157180595 18:45494632-45494654 GAGGCAGGCAGATCAACCTGAGG - Intronic
1158178224 18:54682033-54682055 GAGGCAGGCAGATCAACCTGAGG + Intergenic
1161176042 19:2842400-2842422 AACGCACGCAGACCCACAGCGGG + Intronic
1164987515 19:32659311-32659333 GAGGCGGGCAGATCACCTGCTGG - Intronic
1165699125 19:37924004-37924026 GAGGGAGGCAGATCACCAGAGGG - Intronic
1166329252 19:42069274-42069296 GAGGCCCGAAGACCGACAGCGGG + Intronic
926399543 2:12482959-12482981 GAGGCAGGCAGATCAACCGCTGG + Intergenic
929399673 2:41565552-41565574 GAGGCACTTATATCAACATCTGG + Intergenic
933460363 2:82575804-82575826 GAGGCAGGCAGATCACAGGCAGG - Intergenic
933635282 2:84701916-84701938 AAGGCCCTCAGACCAACAGCAGG - Intronic
936487978 2:112942963-112942985 GAGGCAAGCAAACCATCAGCAGG + Intergenic
938027228 2:127960309-127960331 GAGGCACCAGGAACAACAGCTGG + Intronic
940883659 2:158969841-158969863 GAGGCACGCGGATCTGGAGCTGG - Intronic
943258748 2:185630651-185630673 GAGGCAGGAAGCTCACCAGCAGG - Intergenic
946958881 2:224961734-224961756 GAGGCAGGCAGATCACAAGGTGG - Intronic
948591957 2:239056145-239056167 GAGGCACACATACCCACAGCAGG + Intronic
1172397182 20:34616880-34616902 GAGTCAGGCAGATCAAGATCAGG + Intronic
1173130866 20:40391925-40391947 GAAGCACTCAGAGAAACAGCAGG + Intergenic
1173525531 20:43729743-43729765 GAGGCACGCACCACCACAGCAGG - Intergenic
1175299507 20:57933011-57933033 GAGGCACGCAGGGCAAGGGCTGG + Intergenic
1175763034 20:61573981-61574003 CAGGCACTCAGATCATCAGCTGG - Intronic
1180159112 21:45991184-45991206 GAGGCAGGCAGAGGAGCAGCGGG + Intronic
1180889110 22:19272701-19272723 GAGGCAGGCAGATCACCTGGAGG - Intronic
1182444562 22:30382587-30382609 GAGGCATGGAGCTCTACAGCAGG - Intronic
953026289 3:39147093-39147115 GAGGCAGACAGACCAACAGATGG + Intronic
953607339 3:44420433-44420455 GGGGCATGCAGAGCAACGGCAGG - Intergenic
954069698 3:48133993-48134015 GAGGCAGGCAGATCACCTGAGGG - Intergenic
954111792 3:48437703-48437725 GAAGCAAGCAGACCATCAGCTGG - Intronic
956152884 3:66261621-66261643 GAGGCAAGCTGACCATCAGCTGG - Intronic
956658226 3:71573607-71573629 AAGGCATGCAAAACAACAGCAGG + Intronic
956873569 3:73441181-73441203 GAGGCGGGCAGATCACGAGCTGG + Intronic
958941352 3:100318882-100318904 GAGGCAGGCAGATCACCTGAGGG - Intronic
959376963 3:105599758-105599780 GACTCATGCAGATCCACAGCTGG - Intergenic
960521557 3:118660951-118660973 GAGACAAGCAGAGCACCAGCTGG + Intergenic
962347068 3:134626101-134626123 GAGTCAGGCAGATCAAAATCAGG + Intronic
962834311 3:139173255-139173277 GAGGCAGGCAGATCATGATCAGG - Intronic
965916066 3:173847638-173847660 GAGGCAGGCAGATCACCTGAGGG + Intronic
966865628 3:184257774-184257796 GAGGAAAGCAGATCAATAGGTGG + Intronic
966885379 3:184375017-184375039 GAGGCAGGCAGATCACCTGAGGG - Intronic
967383379 3:188885079-188885101 GAGGGACGCAGCTCAAGAGAAGG - Exonic
968745221 4:2356436-2356458 GGGGCAGGCACATCAACGGCCGG - Intronic
970004978 4:11401573-11401595 GAGGCAGGCAGATCACCTGAGGG - Intronic
971594507 4:28511420-28511442 GAGGCAGGCAGATCACCTGAGGG + Intergenic
971971134 4:33622608-33622630 GAGACACGCAGATGGCCAGCTGG - Intergenic
973262256 4:48177056-48177078 GCTGCAGGCAGATCTACAGCAGG - Intronic
977129478 4:93217621-93217643 CAGGCACACAGGACAACAGCAGG + Intronic
979451484 4:120876190-120876212 GAGACACGCACATCCACATCAGG + Intronic
983574855 4:169249673-169249695 GAGACACACAGAGCAACAGTAGG + Intronic
986768183 5:10947324-10947346 GAGGCAGGCAGATCAACTTGAGG + Intergenic
987932812 5:24424507-24424529 GAGGCAGGCAGATCAACTAAGGG - Intergenic
995033195 5:107502914-107502936 GAGGCACGCCAGTCAACAGATGG + Intronic
996354687 5:122582498-122582520 GGGACACCCATATCAACAGCTGG - Intergenic
997890893 5:137675834-137675856 GAAGCACTCATATAAACAGCAGG - Intronic
1000761238 5:165227348-165227370 GATACAATCAGATCAACAGCTGG - Intergenic
1001139828 5:169135341-169135363 GAGGCAGGCAGATCACCTGAGGG - Intronic
1001257855 5:170198485-170198507 GAGGCACAGAGTTCCACAGCTGG - Intergenic
1001364967 5:171127927-171127949 GAGGCGGGCAGATCATGAGCAGG + Intronic
1003475143 6:6474771-6474793 GAGGCGCACAGAACAACAGGTGG + Intergenic
1004229927 6:13823011-13823033 GAGGCAGGCAGATCACCTGATGG + Intergenic
1004718678 6:18245014-18245036 GAGGAAGGCAGATCAAAAGTGGG - Intronic
1007594380 6:43042570-43042592 GAGGCAGGCAGATCATCTGAGGG - Intronic
1007733568 6:43966347-43966369 GAGGCACTCAGAGGAAGAGCAGG - Intergenic
1013017157 6:106170193-106170215 GAGGCACGCAGCTGCCCAGCAGG - Intergenic
1013345475 6:109256055-109256077 GAGCCACGCAGATCAACCTGGGG - Intergenic
1013508513 6:110822881-110822903 GAGGCAGGCAGATCACCTGGAGG + Intronic
1017775004 6:157673564-157673586 GTGGCATGCAGATCCACACCTGG - Exonic
1018003962 6:159603175-159603197 GAGGCAGTCAGAATAACAGCTGG - Intergenic
1022182171 7:27931581-27931603 GAGGCAGGCAGATCACCTGAGGG + Intronic
1026393062 7:69921832-69921854 GAGGCAGGCAGATCACCTGAGGG + Intronic
1026453213 7:70547482-70547504 GAGGCAGGCAGATCACGAGGTGG - Intronic
1027724624 7:81788550-81788572 GAGGCACACAGATTAAAATCTGG + Intergenic
1029743583 7:102504766-102504788 GAGGCAGGCAGATCACCTGAGGG + Intronic
1032797409 7:135288932-135288954 GAGGCACCCAGACCCACACCTGG + Intergenic
1032832191 7:135639456-135639478 GAGGCAGGCAGATTAACTGAGGG + Intronic
1033705445 7:143881951-143881973 GAGGCACGCAGATCAACAGCTGG - Intronic
1034168045 7:149040781-149040803 GAGGCAGGCAGATCACCTGTGGG + Intergenic
1034545998 7:151789789-151789811 GAGGCACGCAGCTCTCCATCTGG - Intronic
1036927544 8:12921743-12921765 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1038019847 8:23543765-23543787 GAGGCAAGCAGATCAAAACAAGG - Intronic
1039835148 8:41250009-41250031 GAGCCACGCTGATTTACAGCAGG - Intergenic
1042735462 8:71982792-71982814 GAGGCACACAGTTCAAGACCAGG + Intronic
1044208754 8:89523681-89523703 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1048872672 8:138812272-138812294 GTGGCATGCAGATAGACAGCAGG - Intronic
1053402522 9:37838657-37838679 GAGGCAGGCAGATCACCTGAGGG + Intronic
1054763969 9:69027255-69027277 GAGGCACCCAGCTCAGCTGCAGG + Intergenic
1056445743 9:86664971-86664993 GAGGCAAGCATCTCAACACCTGG + Intergenic
1058574167 9:106382154-106382176 GAGGCAAGCAGATCATGAGGTGG + Intergenic
1062097184 9:134709555-134709577 GTGCCACACAGATCACCAGCAGG - Intronic
1185969251 X:4643599-4643621 GAGGCAGGCAGATCATGAGTTGG + Intergenic
1197835719 X:130691709-130691731 GAGGCAGGCAGAACAATAGAAGG - Intronic
1200362421 X:155622772-155622794 GAGTCAAGCAGACCAACAGATGG + Intronic
1200398737 X:156006487-156006509 GAGTCACCGAGATCAAGAGCCGG + Intronic