ID: 1033705921

View in Genome Browser
Species Human (GRCh38)
Location 7:143885048-143885070
Sequence AGCCCCGCGTGCGCCCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033705914_1033705921 16 Left 1033705914 7:143885009-143885031 CCCAAGGGGGTCCCAGGCCAAAA No data
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705912_1033705921 22 Left 1033705912 7:143885003-143885025 CCAAAACCCAAGGGGGTCCCAGG 0: 1
1: 0
2: 2
3: 25
4: 164
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705907_1033705921 30 Left 1033705907 7:143884995-143885017 CCCTGGACCCAAAACCCAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 208
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705915_1033705921 15 Left 1033705915 7:143885010-143885032 CCAAGGGGGTCCCAGGCCAAAAA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705917_1033705921 4 Left 1033705917 7:143885021-143885043 CCAGGCCAAAAACGCGACCACTT 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705911_1033705921 23 Left 1033705911 7:143885002-143885024 CCCAAAACCCAAGGGGGTCCCAG No data
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705909_1033705921 29 Left 1033705909 7:143884996-143885018 CCTGGACCCAAAACCCAAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705916_1033705921 5 Left 1033705916 7:143885020-143885042 CCCAGGCCAAAAACGCGACCACT No data
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data
1033705919_1033705921 -1 Left 1033705919 7:143885026-143885048 CCAAAAACGCGACCACTTTGGCA No data
Right 1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033705921 Original CRISPR AGCCCCGCGTGCGCCCCCCT CGG Intronic