ID: 1033706842

View in Genome Browser
Species Human (GRCh38)
Location 7:143897281-143897303
Sequence TAGGCTAAGGATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 0, 2: 16, 3: 111, 4: 624}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033706842_1033706847 -2 Left 1033706842 7:143897281-143897303 CCTTCCTCCTCATCCTTAGCCTA 0: 1
1: 0
2: 16
3: 111
4: 624
Right 1033706847 7:143897302-143897324 TACTCAATGTGAAGATGACAAGG 0: 24
1: 60
2: 158
3: 267
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033706842 Original CRISPR TAGGCTAAGGATGAGGAGGA AGG (reversed) Intronic
900883313 1:5397852-5397874 GAGCCTTAGAATGAGGAGGAAGG - Intergenic
901458246 1:9376286-9376308 TAGGCTCGGGCTGAGCAGGAGGG - Intergenic
901656454 1:10772437-10772459 AAGGCTGAGGATCAGGAGCAGGG + Intronic
902119158 1:14146963-14146985 TAGGCTGAGAATGAGAAAGAAGG - Intergenic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
902684567 1:18067617-18067639 TAGGGTTAGGATGAGGACCAGGG - Intergenic
902828638 1:18995386-18995408 TGGGCTCAGGATGAGCAAGAGGG - Intergenic
902904147 1:19542096-19542118 CACACTAACGATGAGGAGGAAGG + Intergenic
903207696 1:21795240-21795262 TAAGCGAAGGATGAGGAGGGAGG + Intergenic
903410498 1:23139483-23139505 TAGGCTGAGGAGGGAGAGGAAGG - Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903829222 1:26164696-26164718 TAGGCGAGGGATGTGGAGGGAGG + Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904299601 1:29545835-29545857 CAGGCTGAGGATGAGGACCATGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905212797 1:36385937-36385959 GCGGCTAAGGCTGGGGAGGAGGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905868017 1:41386803-41386825 GAGGTGAAGGATGAGGTGGAGGG - Intergenic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
907228157 1:52969059-52969081 TAGGCTGAGGAGGAAGGGGAAGG + Intronic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907804118 1:57801612-57801634 CATGCTAAGGAGGAAGAGGAAGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908257058 1:62311508-62311530 TATGCAAAGGAGGAGGAGGGAGG - Intronic
908297670 1:62729196-62729218 TATGCTAAGAATGTGTAGGAGGG - Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909976416 1:82050822-82050844 GCTTCTAAGGATGAGGAGGAAGG + Intergenic
910315610 1:85879765-85879787 TAGGCTGAGGAGGTGGAAGAAGG + Intronic
910883913 1:91946507-91946529 TAGGCTAAAGATGGGAAAGAAGG - Intergenic
911076615 1:93881716-93881738 TAAGCTGAGGAGGAAGAGGAGGG - Intergenic
912669895 1:111615996-111616018 TAGGCATAGAATGAGGAAGATGG + Intronic
913062278 1:115219521-115219543 TAGGCGAAGTATGGGGATGAGGG + Intergenic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
914682639 1:149950016-149950038 TAGGCTAAGCATTGGAAGGAAGG - Intronic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915386380 1:155497415-155497437 TAGGCCAAGGAGGAAGAGTAGGG - Intronic
915482596 1:156197254-156197276 CAGGCTGAGGCTGGGGAGGAGGG + Intronic
915523271 1:156460926-156460948 TGGGCCAAAGATGGGGAGGATGG + Intergenic
915677022 1:157541448-157541470 TAGGATAAGGTTGGAGAGGAAGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
915887479 1:159738593-159738615 TAGACTGAGGAAGGGGAGGAAGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916025046 1:160826250-160826272 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
916741272 1:167649186-167649208 TAGTTGAAGGGTGAGGAGGAGGG + Intronic
917482351 1:175423287-175423309 AAGGCTGAGGCTGAGGAAGATGG - Intronic
917529738 1:175823962-175823984 TAAGCTAATAATTAGGAGGATGG - Intergenic
918987855 1:191656874-191656896 TAGGATAAGGATGGTGAGCATGG - Intergenic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919883251 1:201914802-201914824 GAGGCTAAGGCTGTGGAAGAGGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920457205 1:206110279-206110301 TAGGCTGAGGCTGAGGCTGAGGG + Exonic
920707744 1:208266853-208266875 AAGGCAAAGGGTGAGGAGGCAGG - Intergenic
920894163 1:210027514-210027536 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921078743 1:211721813-211721835 TAAGGGAAGGATGAGGAGGAAGG - Intergenic
921129886 1:212210621-212210643 TATGCAAGGGTTGAGGAGGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
922241005 1:223755524-223755546 GAGGATGAGGACGAGGAGGATGG + Exonic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922725027 1:227918596-227918618 TAGGCCTGGGACGAGGAGGAGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922932717 1:229403019-229403041 TAGGCTGGGGATGGGGAGGGTGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923314059 1:232762302-232762324 TAGGCTGAGGAAGAGGAAGAAGG - Intergenic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
923460526 1:234205986-234206008 CACGCTGTGGATGAGGAGGATGG + Intronic
924226313 1:241924580-241924602 TAGGCTGAGGAGGAAGAGGAAGG - Intergenic
924413181 1:243828536-243828558 TAGGCTGAGGAGGAAGAGAAAGG - Intronic
924449107 1:244161852-244161874 GAGGTTTAGGATGAGGATGAAGG - Intergenic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
1063009937 10:2012061-2012083 TAGGCCGAGCATGAGGAGAAAGG + Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063245306 10:4211736-4211758 TGGGCCGAGGAGGAGGAGGAAGG + Intergenic
1063740943 10:8818461-8818483 TGCTCTAAGGGTGAGGAGGAAGG + Intergenic
1064080134 10:12301742-12301764 AAGGCCAGGGATGAGGACGATGG + Intergenic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065186772 10:23175922-23175944 TTGGCCAAGGATAAGGAAGATGG + Intergenic
1065578539 10:27148530-27148552 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1065739080 10:28780597-28780619 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1065909282 10:30287294-30287316 TAGGCACAGGATGAGGGGTAGGG + Intergenic
1067013120 10:42732913-42732935 TGGGCTAAGGAGGAAGAGGAGGG + Intergenic
1067310715 10:45111187-45111209 TGGGCTGAGGAGGAAGAGGAGGG - Intergenic
1068196765 10:53727168-53727190 TAGGCACAGGATGGGGAGAATGG + Intergenic
1068744415 10:60513985-60514007 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071489381 10:86125731-86125753 TAGGCTGAGGAAGAGGCGGAAGG - Intronic
1072202483 10:93173318-93173340 CAGGCTAAGGGTGGGAAGGAAGG - Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072642053 10:97219093-97219115 TAGGTTGAGGAGGAAGAGGAGGG - Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1074107193 10:110397343-110397365 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1074345461 10:112681182-112681204 GAGGCTAAGGTGGAGGTGGAAGG - Intronic
1075045742 10:119145193-119145215 TAGGCTGCGGAGGAGGAAGAGGG - Intronic
1075139494 10:119818592-119818614 TAGGCGTAGGATGCGCAGGATGG + Intronic
1075172702 10:120130702-120130724 TATGTTAAGGAGGAGGAGTAAGG + Intergenic
1076416243 10:130291507-130291529 CACACTAATGATGAGGAGGAAGG + Intergenic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1078619054 11:12891161-12891183 TAGGATAGGAATGAGAAGGAAGG - Intronic
1078727559 11:13945219-13945241 TGTGCTAAGGAGGAGGGGGAGGG + Intergenic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG + Intronic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1079350190 11:19685496-19685518 AATGTTAAGGAAGAGGAGGAAGG + Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079976467 11:27097911-27097933 TAGCTTGAGGATGGGGAGGAAGG - Intronic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1081156094 11:39692921-39692943 TAGGCTGAGGAGGAAGAGAAGGG - Intergenic
1081523109 11:43902096-43902118 GAGGCTAAGGAAGAGGAAGGAGG + Intronic
1081548722 11:44092762-44092784 TAGGCCAAGGAGGAGAAGGAAGG + Intergenic
1081606451 11:44530095-44530117 TAGAGGAAGGATGAGGATGATGG - Intergenic
1082301248 11:50509145-50509167 CACACTAATGATGAGGAGGACGG + Intergenic
1084137597 11:67198080-67198102 TAGGCTAAGGAGGAAGAGGTGGG + Intronic
1084433550 11:69124633-69124655 GAGGCTAAGTCAGAGGAGGAGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085027719 11:73246708-73246730 TAGGCTGAGGAAAAGGTGGAAGG - Intergenic
1085836829 11:79965986-79966008 GTGGCTAAAGAAGAGGAGGAGGG - Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1088664078 11:112076682-112076704 TAGGCTGAGGAGGAAGAAGAGGG + Intronic
1089613986 11:119684964-119684986 TACACTCAGGATGGGGAGGAGGG + Intronic
1089876796 11:121730209-121730231 GAGGGTAAGGAAGAGAAGGAGGG - Intergenic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1091144954 11:133271019-133271041 TATGCTGAGGCTGATGAGGAAGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092112791 12:5975871-5975893 AAGGCTAGGGGTGAGGAAGAGGG - Intronic
1092132533 12:6122865-6122887 GGGGCACAGGATGAGGAGGAAGG - Intronic
1092198656 12:6566108-6566130 AACTCTGAGGATGAGGAGGAAGG - Exonic
1092210522 12:6643452-6643474 TAGGCTATGGGAGTGGAGGATGG - Intronic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1096001794 12:48136186-48136208 GAGGTTAAGAATGAGGAGGGAGG - Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1096809044 12:54158159-54158181 TTGGCTGAGGAAGAGGGGGAAGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097182150 12:57177719-57177741 TGGGCACAGGAGGAGGAGGACGG + Intronic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1100144149 12:91656723-91656745 TAGCCTGGGAATGAGGAGGAGGG - Intergenic
1101294520 12:103407417-103407439 TATGCTGAGGAAGAAGAGGAGGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103188527 12:118981399-118981421 GAGGCTGAGCCTGAGGAGGAGGG + Intergenic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1104103089 12:125634151-125634173 AAGGCGAAGGAAGAGGGGGAAGG - Intronic
1104456613 12:128919159-128919181 TAGAGTAAGGTTGATGAGGACGG - Intronic
1105277551 13:18944535-18944557 AGGGGTAAGGATGAGGAGGCTGG - Intergenic
1105633485 13:22195011-22195033 TAAGCCAAAGATAAGGAGGAAGG + Intergenic
1105659132 13:22473588-22473610 TATGATAATGATGAGGAGGATGG + Intergenic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1106846013 13:33738525-33738547 TAAGCTAAGGAAGAGGAAGAGGG - Intergenic
1106926253 13:34616118-34616140 TAGGCTGAGGGTGAGGTGGGTGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107374854 13:39792547-39792569 TAGGCTGAGGAGGAGGAGAAAGG + Intergenic
1108884145 13:55158138-55158160 TAGGCTGAGAAAGAGGAAGAAGG - Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1112301845 13:98238268-98238290 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113661111 13:112106925-112106947 TAGGGGTAGGAAGAGGAGGAGGG + Intergenic
1115161651 14:30403226-30403248 TAGGCTGAGTTTGAGGAAGATGG - Intergenic
1115613638 14:35072401-35072423 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116132187 14:40869264-40869286 TAGGCTGAGGACGAAGAGGAAGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1116722857 14:48523071-48523093 TGGGCTGAGGAGGAAGAGGAGGG + Intergenic
1117082337 14:52165299-52165321 CACACTAATGATGAGGAGGAAGG + Intergenic
1119513257 14:75228203-75228225 TGGGCTGAGGATGAGGAAGCCGG + Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1120046675 14:79815565-79815587 AAGGCGAAGAAAGAGGAGGAGGG + Intronic
1120331529 14:83099454-83099476 GAGGCTGAGGCTGAGGAGGGAGG + Intergenic
1120468871 14:84897269-84897291 AAAGCTAAGGATGAGGAAAATGG - Intergenic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1122655141 14:103253680-103253702 GAGGCCAAGGATTGGGAGGAGGG - Intergenic
1122972434 14:105157900-105157922 TGGCCTGAGGATGAGGAGGGTGG - Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123205323 14:106707140-106707162 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123210367 14:106754407-106754429 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123677820 15:22729218-22729240 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1123895810 15:24828912-24828934 TGGACTAAGGATGGGGAGGCTGG + Intronic
1124330021 15:28803482-28803504 TAGGCTGAAGAAGAGGAGGAAGG + Intergenic
1125244012 15:37613153-37613175 GAGGCTAAAGATGTGGATGAGGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126120166 15:45244506-45244528 TAGGCTGAGGAGGAGAAGGAAGG + Intergenic
1126318843 15:47400041-47400063 TAGCTTAAGGATGGTGAGGAGGG - Intronic
1126705648 15:51402657-51402679 TAGGAGAAGGATGAGGGAGAGGG - Intronic
1128496143 15:68199735-68199757 GAGACTAAGGATGGGGAGGGCGG - Intronic
1128556938 15:68638186-68638208 TGGGCTGAGGGTCAGGAGGAGGG - Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1129102332 15:73277594-73277616 TAAGCTAAGCAGGAGCAGGAAGG - Intronic
1129240978 15:74252121-74252143 AAGGCAAAGAATGAGGTGGAGGG - Intronic
1129308604 15:74687761-74687783 TAGGCAAAGGTTGATCAGGAAGG - Intronic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1129905757 15:79186074-79186096 TAGGTGAAGGAGGAGGAGAAAGG + Intergenic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1131017853 15:89072506-89072528 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131017865 15:89072536-89072558 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131143099 15:89993506-89993528 TAGGGTGGGAATGAGGAGGATGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134226317 16:12393709-12393731 GAGGCTGAGGAAGAGGAGAAGGG + Intronic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134803593 16:17106915-17106937 TACTCTGAGGATGAGGAGGATGG + Exonic
1134856506 16:17524390-17524412 TAGGCAAGGGATGTGGAGGGTGG + Intergenic
1135008964 16:18856063-18856085 TAAGATAAAGATGAGGAAGAAGG - Intronic
1135834350 16:25811288-25811310 TAGGCTGAGGAAGAGGAGGAAGG - Intronic
1135980419 16:27142802-27142824 TAGTCAAAGGATGAGGTGGGAGG - Intergenic
1136498514 16:30658448-30658470 TAGGCTGAGGAGGAAGAGGGAGG + Exonic
1137093652 16:36225511-36225533 TAATCTAAGGATGAGGAGTGAGG - Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137401221 16:48155842-48155864 TGGGCTGAGGATGAGAGGGAGGG + Intronic
1137481925 16:48858995-48859017 TGGGCTAAGCATGGGGAGGGGGG + Intergenic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140571948 16:76117960-76117982 TGGGCTAGGGATGAGCAGAAAGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141264301 16:82482209-82482231 TCGGCTGAGGGTGAGGAGCAGGG + Intergenic
1141320744 16:83006465-83006487 AAGGCTAAGCCTGAGGATGATGG + Intronic
1141651434 16:85395115-85395137 AAAGCTGAGGATGAGGAGGAAGG + Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142177018 16:88650133-88650155 GGGGCTGAGGGTGAGGAGGAGGG - Intronic
1142340204 16:89517020-89517042 TGGGCTGAGGAGGAGGACGAGGG + Intronic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143615539 17:8047152-8047174 GAGGCTCACGTTGAGGAGGAGGG + Intronic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144580466 17:16456173-16456195 TAGGAGGAGGAAGAGGAGGAAGG + Intronic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145302471 17:21650332-21650354 TATGCTGAGGAGGAGGATGATGG + Intergenic
1145810069 17:27759220-27759242 CAGGCTCAGGATGAGGTGCATGG + Intronic
1145857605 17:28177124-28177146 TAGGCTGAGGAGGAAGAGAAAGG + Intronic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1146293974 17:31633804-31633826 CACACTAACGATGAGGAGGAAGG + Intergenic
1146370768 17:32264646-32264668 TAGAGTAGGGATGGGGAGGAGGG + Intergenic
1147121792 17:38339398-38339420 CCAGGTAAGGATGAGGAGGATGG - Exonic
1147178928 17:38673160-38673182 TCTGCAAAGGATGAGGGGGAGGG + Exonic
1147374640 17:40016360-40016382 AAGGCTAATGAGGAGGGGGAAGG + Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148596856 17:48863435-48863457 AACACCAAGGATGAGGAGGAAGG - Exonic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1148776977 17:50101504-50101526 AAGGCAAAGGCTGGGGAGGAGGG - Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1148905838 17:50911631-50911653 TAAGGTAGGGGTGAGGAGGAGGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149669442 17:58393026-58393048 TAGGTTAAGGAGGAAGATGAGGG - Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149819851 17:59765685-59765707 GAGGCTGAGGAGGAGGCGGAGGG + Intronic
1149856011 17:60083524-60083546 TTGGTTAAAGGTGAGGAGGAGGG - Intergenic
1150125995 17:62635388-62635410 AAGTGTAAGGATGAAGAGGAAGG - Intronic
1150215732 17:63468040-63468062 GAGGCTGAGGCTGAGGAGAATGG - Intergenic
1150381037 17:64719669-64719691 GAGGCTGAGGCTGAGGTGGAAGG + Intergenic
1150674645 17:67234522-67234544 TAGAGTAAGGATGAGTATGATGG - Intronic
1150775469 17:68078448-68078470 GAGGCTGAGGCTGAGGTGGAAGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151723164 17:75869777-75869799 GAGGACAAGGATGAGGAGAAGGG + Intergenic
1152025522 17:77806460-77806482 TAGGCTGGGGAAGAAGAGGAAGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152703665 17:81832376-81832398 TGGGATCAGGATGGGGAGGAGGG - Intronic
1153365092 18:4247072-4247094 TAGGACAAGGAGGAGAAGGAAGG + Intronic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153753945 18:8261233-8261255 AAGGCTAAGGATGGGGAGCTGGG + Intronic
1153970791 18:10225263-10225285 TACACTAATGATGAAGAGGAAGG - Intergenic
1154031349 18:10756619-10756641 TAGATGGAGGATGAGGAGGAGGG + Intronic
1155169895 18:23259654-23259676 GAGGCAAAGGAAGTGGAGGAGGG + Exonic
1155890370 18:31260875-31260897 AAGTCTAAGGATGAGAATGAAGG + Intergenic
1156053412 18:32968135-32968157 GAGGCTAGAGAAGAGGAGGATGG - Intronic
1156106515 18:33669280-33669302 CAGGCTAAAGGTGAGAAGGATGG + Intronic
1156276117 18:35584408-35584430 TGGGCTGAGGTAGAGGAGGAAGG + Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156695314 18:39759371-39759393 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157172673 18:45422492-45422514 TAGGCTAAGCGTGAGGTGGAAGG + Intronic
1157573309 18:48727817-48727839 TAGTCCAAAGATGAGGTGGAGGG - Intronic
1157929950 18:51810824-51810846 TAGGCTGAGGAAGAAAAGGAGGG + Intergenic
1158089396 18:53692999-53693021 GAGGCTGAGGATGAGGATGAGGG + Intergenic
1158532376 18:58275297-58275319 TAAGCTGAGGAGGAAGAGGAGGG + Intronic
1158665140 18:59425738-59425760 GAGGCTGAGGAAGAAGAGGAGGG - Intergenic
1160015567 18:75137758-75137780 GAGGCTGAGGATGAAGATGAGGG - Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160667662 19:340575-340597 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1161865546 19:6829671-6829693 TTGGCCAAGGAGGAGGAGAAGGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1164416346 19:28049201-28049223 TAGGCTGAACCTGAGGAGGATGG + Intergenic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164868744 19:31626014-31626036 GAGGGGGAGGATGAGGAGGAAGG - Intergenic
1165181695 19:33977152-33977174 AAGGCACAGGATGAGGTGGAAGG + Intergenic
1165445887 19:35856645-35856667 CAGGCAAGGGGTGAGGAGGAGGG - Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1167022158 19:46885435-46885457 TAAGCTAAGGATTCAGAGGAAGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926209311 2:10857525-10857547 GAGACGAAGGAAGAGGAGGAGGG - Intergenic
926559756 2:14403049-14403071 CAGCCTGAGGATGAGGAAGAAGG + Intergenic
926582917 2:14651048-14651070 TATGATGAGGATGAGCAGGATGG - Intergenic
926962899 2:18378301-18378323 AAGGCCAAGGATGAGGAGTCAGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
928082110 2:28320694-28320716 AGGGCTAAGGCTGAGCAGGAAGG - Intronic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
929215652 2:39409082-39409104 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
929736484 2:44555437-44555459 TAGGGTGAGGATGGGGAGGGAGG + Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930364627 2:50424123-50424145 GAGGCGGAGGAGGAGGAGGAGGG + Intronic
931075430 2:58706302-58706324 TAGTCTTAGTAAGAGGAGGAGGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
932710149 2:74057045-74057067 TGGGCTGAGGATGAGGATGGTGG + Intronic
933258534 2:80107273-80107295 TAGGCACAGGATGGGGAGCAGGG - Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934653540 2:96105544-96105566 TAGGCTGAAGATGGGCAGGAAGG - Intergenic
934753847 2:96811460-96811482 TGGGCCAGGGAAGAGGAGGAGGG - Exonic
935211132 2:100940100-100940122 TAGGCAAAGGCTGCTGAGGATGG + Intronic
935292241 2:101620509-101620531 CAGGCTGAGGATGGTGAGGAAGG - Intergenic
935840611 2:107105715-107105737 GAGGCTAAGGCTGAGGTGGGAGG - Intergenic
937110333 2:119362068-119362090 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
937507885 2:122557435-122557457 TAGGGTAATGATGAGGATAAAGG + Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
939027071 2:137026660-137026682 AAGGCTAAGGGTGAGAAGCATGG - Intronic
939114735 2:138047526-138047548 TAGACTAAGATTGAGGATGAAGG + Intergenic
939911107 2:147984237-147984259 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
940301536 2:152180717-152180739 CACGCTGATGATGAGGAGGAAGG - Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941343364 2:164336149-164336171 TAGGCCATGCATGTGGAGGAGGG + Intergenic
941358475 2:164521692-164521714 GAAGCCAAGGATGAGGAGAAAGG + Intronic
941515522 2:166471130-166471152 GAGGATGAGGATGAGGATGATGG + Intronic
942146922 2:173035907-173035929 TAGGCTCAGGAGGAGGAGAAGGG + Intronic
942530534 2:176905042-176905064 AACGCTGAGGATGTGGAGGAAGG + Intergenic
943103513 2:183514278-183514300 TAGGCTGAGGAGGAAGAGGAGGG - Intergenic
943314192 2:186365526-186365548 TAGCCTGAGGATGAGGACAACGG + Intergenic
944150637 2:196554520-196554542 TAATCAAAGAATGAGGAGGATGG + Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944200084 2:197097618-197097640 TGGGCTAAAGATGAGGCTGAGGG - Intronic
944203944 2:197137311-197137333 TAGCCTTAGGATGATGAGGAAGG + Intronic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945199744 2:207269469-207269491 TAGGATAAGTATGTGGAGGGTGG - Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945275280 2:207982011-207982033 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
945642211 2:212444104-212444126 CAGGCTGGGGAAGAGGAGGAGGG - Intronic
946127297 2:217574186-217574208 TAGGCTGGTGATGAGGAGCAAGG + Intronic
946400359 2:219465284-219465306 GAGGCGAAGGGTGAGGTGGAAGG - Intronic
946429787 2:219619172-219619194 GAAGATGAGGATGAGGAGGAAGG + Intergenic
946621724 2:221570251-221570273 TAGGCTAATGTTGAAGGGGAGGG - Intronic
946772157 2:223099838-223099860 TAGGTGGAGGATGAGGAGAAGGG + Intronic
946943140 2:224791234-224791256 TAAGCAATAGATGAGGAGGAAGG + Intronic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
947551318 2:231048678-231048700 TGGTGTGAGGATGAGGAGGACGG + Exonic
947878092 2:233480911-233480933 GAGGCTGCGGGTGAGGAGGAAGG + Intronic
947894765 2:233659557-233659579 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948087957 2:235266612-235266634 CAGGCTTGGGATGAGGACGATGG - Intergenic
948135741 2:235634946-235634968 GAGGCTGAGGGTGAGGAGGTGGG - Intronic
948540245 2:238686139-238686161 TCGGCTGAGGCTGAGGAGGGTGG - Intergenic
948603243 2:239119406-239119428 CAGGCTAAGGATGAGGAGACAGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1170389740 20:15859206-15859228 TGGGCTGAGGAGGAAGAGGAAGG + Intronic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171219758 20:23384511-23384533 GAGGCTAAGGCTGAGGTGGGAGG + Intronic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1172244401 20:33435892-33435914 TAATCTAAAGATGAGGAGGTGGG + Intronic
1173200784 20:40953640-40953662 CAAGCTAAGGATGAGGAAGTTGG + Intergenic
1173538983 20:43837603-43837625 TAGGCTGGGGAGGAAGAGGAGGG + Intergenic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174230946 20:49045243-49045265 TAGGTTATGGATGGGGAGGAGGG + Intergenic
1174610953 20:51798561-51798583 TAGGCTAAAGGTGATGAGGAAGG + Intronic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1175560437 20:59923778-59923800 TAAGCTAAGTGTGAGGAGGGAGG + Intronic
1175671476 20:60906827-60906849 GAGGCTAATAATGATGAGGATGG + Intergenic
1176653199 21:9568137-9568159 TATGCTGAGGATGATGATGATGG + Intergenic
1177449417 21:21245859-21245881 GAGGATAAGGAAGAGAAGGAAGG + Intronic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178053019 21:28768553-28768575 TAGGCTGAACATGAGGAGAAGGG - Intergenic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179455428 21:41496589-41496611 TAGGCTGAGGAAGGGGAGGTGGG - Intronic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180557020 22:16586265-16586287 TAGGGTAAGAATGAGGGAGATGG - Intergenic
1181534212 22:23533385-23533407 GAGACAAAGGCTGAGGAGGAAGG + Intergenic
1181826127 22:25517508-25517530 TAGGCTGAGGGAGAGGAAGAGGG + Intergenic
1182114917 22:27750838-27750860 TGGGGTAAGGTTGAGGGGGAAGG + Exonic
1182254918 22:29031246-29031268 TAGGGTGGGGATGAGGAGGGTGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183349752 22:37328449-37328471 TAGGCTAAGGAGGAGAAACAGGG - Intergenic
1183760017 22:39807519-39807541 GAGCCTCAGGATGAGGTGGATGG - Intronic
1184244035 22:43226957-43226979 GAGGCTGAGGGGGAGGAGGAGGG - Intronic
1184553480 22:45218691-45218713 CAGGCTAAGGATAAGGATGTGGG - Intronic
1184612450 22:45613404-45613426 TAGGCTGAAGGGGAGGAGGATGG - Intergenic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951685897 3:25344052-25344074 TAGGCTAAGGATCAGGAGCCTGG + Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952488425 3:33840322-33840344 TAGGCTGAGGAAGAGGCGGAAGG + Intronic
953279235 3:41536724-41536746 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
953472978 3:43182429-43182451 TAAGTTAAGGAAGAGGAGAAAGG + Intergenic
954171086 3:48803046-48803068 TCTGCTAAGGATGAGGAAGGAGG + Intronic
954231307 3:49219844-49219866 CATACTAATGATGAGGAGGAAGG + Intronic
954363550 3:50134710-50134732 CAGGCTAGGGCTGGGGAGGAGGG + Intergenic
955139176 3:56252090-56252112 AATGCTAAGGATGAGGAGCAAGG - Intronic
955229660 3:57087413-57087435 TAAGCTAAGCAGGTGGAGGAGGG - Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955863386 3:63356025-63356047 AAGGCCAAGGATGAGTAGGAGGG - Intronic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
957640782 3:82850422-82850444 TAGGAAGAGGAAGAGGAGGAGGG - Intergenic
957672216 3:83319956-83319978 TAGGCTATTGATGAGGAGCAGGG + Intergenic
958785882 3:98595518-98595540 GAGGCTAAGGATGAGAGGGATGG - Intergenic
959067471 3:101673152-101673174 TAGGGTAGGGGTGAGGAGGCAGG + Intronic
959197904 3:103209642-103209664 CACACTAATGATGAGGAGGAAGG + Intergenic
959236226 3:103726219-103726241 TCCACTAAGGATGAGGATGAAGG - Intergenic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
961081310 3:124031506-124031528 TAGGCAAAGGATTAAGGGGAAGG + Intergenic
961338849 3:126203769-126203791 TAGGCTGAGAAAGAGAAGGAGGG + Intergenic
961859311 3:129901944-129901966 CACCCTAATGATGAGGAGGAAGG + Intergenic
962022325 3:131513555-131513577 TAGGCTAAGGGAGAAGAGGGAGG + Intergenic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
966103861 3:176311209-176311231 TAGGCTAGAAATGAGGAGGGCGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
966968419 3:185019073-185019095 CACTCTAATGATGAGGAGGAAGG - Intronic
967815882 3:193797760-193797782 GAGGCTGAGGGTGAGGAAGAAGG + Intergenic
969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG + Intronic
969657604 4:8507198-8507220 TAGGCCAGGGCTGAGGTGGAGGG - Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970153675 4:13118660-13118682 TAGGCAAAGGATGGGTAGGAGGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971361993 4:25946627-25946649 TAGGCAGAGGAGGAGAAGGAGGG + Intergenic
971855016 4:32032007-32032029 TAAGCCAAGGAAGATGAGGAGGG + Intergenic
972882930 4:43447887-43447909 TAGGCTAGGGGAGAGAAGGAAGG + Intergenic
973330313 4:48905964-48905986 TAGGATGAGGATGAGGATGAGGG + Intronic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
975176996 4:71300287-71300309 CAGGCTAATGATGAGCAGCATGG + Intronic
976153722 4:82119870-82119892 TAGGCTGAGGAAGGCGAGGAGGG + Intergenic
976426845 4:84913906-84913928 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976956117 4:90902651-90902673 AAGGCTTAGGGTGAGGAGGAAGG + Intronic
977443722 4:97101908-97101930 CACACTAATGATGAGGAGGAAGG - Intergenic
977451693 4:97206995-97207017 TAGCCTAAGGAGGAGTGGGAGGG + Intronic
978825437 4:113016856-113016878 GAGGCTGAGGCTGAGGAGCATGG + Intronic
978863765 4:113482387-113482409 AAGACTAAGGATGATGATGAAGG + Intronic
979982766 4:127276759-127276781 CACACTAATGATGAGGAGGAAGG - Intergenic
980239415 4:130154059-130154081 TAGGCTAAGAATGGGTATGAAGG - Intergenic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
980734451 4:136867193-136867215 TAAGCAAAGGATGGGGAGTATGG - Intergenic
980907553 4:138962981-138963003 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
981495484 4:145386983-145387005 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
982123363 4:152162888-152162910 GAGGATAAGGAAGAGGAGAAAGG + Intergenic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
983383547 4:167027803-167027825 TAAGCCGAGGAGGAGGAGGAAGG + Intronic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984984234 4:185312065-185312087 AAAGCTAATGAGGAGGAGGAAGG - Intronic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985766285 5:1781430-1781452 GAGGCTAAGGGTGAGGCTGAGGG - Intergenic
985766292 5:1781460-1781482 GAGGCTAAGGGTGAGGCTGAGGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987456897 5:18158294-18158316 TAAGCCAAGCATTAGGAGGAAGG + Intergenic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
988048800 5:25996521-25996543 TATACAAATGATGAGGAGGAGGG + Intergenic
988153142 5:27413885-27413907 TGGGGAAAGGAAGAGGAGGAGGG - Intergenic
988296027 5:29363379-29363401 TAAGCTGAGGAGGAGGAAGAGGG + Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988573453 5:32395677-32395699 TAGGCTGAGGAAGAAGAGGAGGG - Intronic
989758700 5:44986938-44986960 CACACTAATGATGAGGAGGAAGG + Intergenic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
991057297 5:62334527-62334549 TAGGAGAAGGAAGAGGAAGAGGG - Intronic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
991428493 5:66517496-66517518 TTGGCTAAGAATCAGGAGCATGG + Intergenic
991499396 5:67261824-67261846 TGGGCTCAGGAGGAGGAAGAAGG + Intergenic
991979712 5:72218464-72218486 AAGGCTAAGGATTAGCAGGCAGG + Intergenic
992927723 5:81607206-81607228 TAGGATAATGATGAGAATGAGGG + Intronic
993310167 5:86319813-86319835 TAGGCTGAAGATGAGCATGAGGG + Intergenic
993347505 5:86802888-86802910 TAAACTGAGGAAGAGGAGGAAGG - Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995195233 5:109359066-109359088 TAAGCTGAGGAGGAAGAGGAGGG - Intronic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996308387 5:122077079-122077101 TGGGCGAAGGGTGAGGAGTAAGG - Intronic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
998915745 5:147009524-147009546 AAGACGAAGGATGAGGTGGAAGG + Intronic
1000752481 5:165113951-165113973 TAGGCTGAGGATGGGGAAGAAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1002189103 5:177469669-177469691 AAAGCTAGGGAGGAGGAGGAAGG - Intronic
1002547937 5:179963981-179964003 TAGTCAAAGGCTGAGGAGCACGG + Intronic
1003027691 6:2571483-2571505 TAAGCTAAGGATGTTGAGGTTGG - Intergenic
1003355518 6:5365948-5365970 TAGGCTGAAGAGGAAGAGGAGGG + Intronic
1003781951 6:9439228-9439250 TAGGCTGAGAAGGATGAGGAGGG + Intergenic
1003828143 6:9975069-9975091 GAGGCCAGGGATGTGGAGGAAGG + Intronic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004618788 6:17315248-17315270 TAGGCTAAGAAAGATGAGAACGG + Intergenic
1004710089 6:18161628-18161650 TAGGCTAGGGATAAGTAGGGAGG - Intronic
1004719547 6:18255399-18255421 TGGGCTGAGGATGAGGTGCAAGG - Intronic
1005272262 6:24179082-24179104 AAGGCTAAGGATGAGGGCAATGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006645556 6:35512231-35512253 GAGGCTAAGGAAGAAGAGGACGG - Exonic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008321837 6:50123691-50123713 CAGGCTGTGGATCAGGAGGATGG - Intergenic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1009955538 6:70448332-70448354 CACACTAATGATGAGGAGGAAGG - Intronic
1010187128 6:73157326-73157348 AGGGCTGAGGAAGAGGAGGAAGG + Intronic
1010746317 6:79566060-79566082 TAGTCTTGGGGTGAGGAGGATGG + Intergenic
1011132131 6:84062724-84062746 GATGTAAAGGATGAGGAGGAGGG - Intronic
1011626797 6:89289689-89289711 AAGGGGAAGGGTGAGGAGGAGGG + Intronic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012101821 6:95099067-95099089 TATGGTAATGATGAGGAGGCAGG + Intergenic
1012234655 6:96799201-96799223 TATGCTAATGATGAGCAGGATGG + Exonic
1013383046 6:109596423-109596445 TAGGATGAGGATGAGGAGTTTGG - Intronic
1013437649 6:110127809-110127831 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1013519250 6:110917447-110917469 CACACTAATGATGAGGAGGAAGG + Intergenic
1013628841 6:111965078-111965100 GAGGCGGAGGAGGAGGAGGAGGG + Intergenic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015687556 6:135882087-135882109 TAGGCTTGGGATGAGAAGGAAGG + Intronic
1018217368 6:161542037-161542059 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018687085 6:166311649-166311671 TAGGCTGAGGAGGAAGCGGAGGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019251588 7:16659-16681 GAGGGTGAGGATGAGGATGAGGG - Intergenic
1019295492 7:271954-271976 ACGGCTGAGGATGTGGAGGAGGG + Intergenic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020439765 7:8204971-8204993 TACACTAAGGATAAGGAAGAGGG + Intronic
1020677308 7:11197456-11197478 TAGATTAAGGATAAGGATGAAGG - Intergenic
1020808055 7:12815034-12815056 TAGGCTAAGGAGAAGGTGCATGG + Intergenic
1020925639 7:14320437-14320459 TAGTCTAAGGCTGTGGAGCAAGG - Intronic
1020958479 7:14772876-14772898 AAGGGGAAGGATGAGCAGGAGGG - Intronic
1021746594 7:23746730-23746752 TAGGCTGAGGAGGAAGAGCATGG + Intronic
1021758308 7:23877402-23877424 TGGGTTAAGGAGGAGGATGATGG + Intergenic
1022126136 7:27359428-27359450 GAGGGTGAGGAAGAGGAGGAGGG + Intergenic
1022145874 7:27539966-27539988 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022952479 7:35351762-35351784 TGGGCTGAGCATGAGGAGGGAGG + Intergenic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023409358 7:39874004-39874026 TGGGATAAGGAAGATGAGGAAGG - Intergenic
1023745334 7:43317856-43317878 TCAGCAAAGGATGACGAGGATGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1025043574 7:55670024-55670046 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025136494 7:56418533-56418555 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1027544005 7:79503715-79503737 TAGACTGAGGAAGAGGAGAAGGG + Intergenic
1027613559 7:80392818-80392840 TGGGGTGGGGATGAGGAGGATGG + Intronic
1028386559 7:90260415-90260437 GAGGCTGAGGCTGAGGTGGAAGG + Intronic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029351099 7:100013496-100013518 TAAGCTGAGGAGGAAGAGGAAGG - Intergenic
1029595955 7:101537795-101537817 GAGGCTAGGGTGGAGGAGGAGGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1031145217 7:117989949-117989971 TAGGCTAACAAAGAAGAGGAAGG - Intergenic
1031393718 7:121247513-121247535 GATGCTAAGGCTGAGGAGGGAGG + Intronic
1031798444 7:126209674-126209696 TAGGATGATGATGGGGAGGAAGG - Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032829657 7:135610010-135610032 TAAGCCAGGGATGAGTAGGAAGG - Intronic
1032856444 7:135837543-135837565 TGGGCCAAGGAAGAAGAGGAAGG + Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034238780 7:149593527-149593549 TAGGCTGAGGAGGAGGATGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034620310 7:152451729-152451751 TAGGGTAAGAATGAGGGAGATGG + Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036916661 8:12810795-12810817 TAGGTTATGGAAGAGGAGAAAGG - Intergenic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037613819 8:20499037-20499059 TAGGCTGAGGAGGAAGATGAGGG - Intergenic
1038699595 8:29837176-29837198 GAGTCTAAGTATGAGGAGGAAGG + Intergenic
1038864522 8:31424994-31425016 GAGGCTGAGGATGAGGCAGAAGG + Intergenic
1039661331 8:39470645-39470667 TAGGCAAAGGTTGAGGGGGTGGG - Intergenic
1039691671 8:39871092-39871114 CACACTAATGATGAGGAGGAAGG + Intergenic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1041131986 8:54710815-54710837 TAGGCACAGGATGGGGAGGTGGG + Intergenic
1041191218 8:55356849-55356871 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1041225072 8:55689715-55689737 TAGGCCAGAGATGAGGAAGAAGG + Intergenic
1041703118 8:60814169-60814191 GAGGCTTAGGAAGAAGAGGAAGG - Intronic
1042154929 8:65834178-65834200 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1043094184 8:75945783-75945805 TAGGCTGAGGAAGAGGAAGAGGG - Intergenic
1043413497 8:80024760-80024782 TATGCAAAGGATGAAGAGGGTGG + Intronic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044653084 8:94519261-94519283 TATGATCAAGATGAGGAGGAAGG - Exonic
1045224902 8:100234925-100234947 GGGGCCCAGGATGAGGAGGAAGG + Intronic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045501437 8:102747205-102747227 TGGGCTAAGGCTCAGGGGGAAGG + Intergenic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046741962 8:117838921-117838943 TAGGCTAATGATGAGAATGTGGG - Intronic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048618344 8:136104132-136104154 TAGGGTAGGGGTGAGGAGAAGGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049155460 8:141063588-141063610 GAGGTCAAGGCTGAGGAGGAAGG + Intergenic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1050113763 9:2242344-2242366 TACACAAAGGATGAGGATGAGGG - Intergenic
1050293600 9:4181702-4181724 TTGGCTAATGATGCAGAGGAAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051284986 9:15487103-15487125 TGGGCTCAGGCTGAGGAGGGAGG - Intronic
1051489711 9:17647919-17647941 TAGGCTGAGGTGGAAGAGGAAGG - Intronic
1052559422 9:30065420-30065442 TATGCTGAGGAGGAAGAGGAGGG + Intergenic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054941750 9:70750571-70750593 GAGGCTCAGAATGAGGATGATGG + Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055413758 9:76060457-76060479 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055773951 9:79747811-79747833 TATCCTAGGGATGGGGAGGAAGG - Intergenic
1056165685 9:83938850-83938872 TAGGCTGAGGCTGAGGAGGGTGG - Exonic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1058579854 9:106443380-106443402 GGGGCTAATGATGAGGAGGAAGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059178853 9:112192923-112192945 TATGCTAAGGAAGAGGAATAAGG - Intergenic
1059757237 9:117304872-117304894 CAGGCTGAGGGTGGGGAGGAGGG + Intronic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1061133535 9:128721200-128721222 TGGGCTGAGGAGGAGGAAGAGGG - Exonic
1061223682 9:129267497-129267519 TGGGCGAGGGACGAGGAGGAGGG + Intergenic
1061452628 9:130676823-130676845 TAGGCTGAGTCTCAGGAGGATGG + Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061700433 9:132411099-132411121 GAGGCTAAAGGTGGGGAGGAGGG - Intronic
1062303944 9:135891309-135891331 TAGGCAGAGGCTGAGGAAGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186368770 X:8925372-8925394 TAGGCTGAAGAGGAAGAGGAAGG + Intergenic
1186451431 X:9677090-9677112 GAGGCCAAGGATGAGGAAGTGGG - Intronic
1187342773 X:18436223-18436245 TAGGCTGAGGAGGAAGAGGGAGG + Intronic
1187547618 X:20267959-20267981 TGGGCGGAGGAGGAGGAGGAGGG + Intergenic
1187947026 X:24436020-24436042 TAGGATAAGGATGAGGTAGGAGG - Intergenic
1187995765 X:24924790-24924812 TTGGGTAAGGGTGTGGAGGAAGG + Intronic
1189354036 X:40298181-40298203 TCGGCAGAGGAGGAGGAGGAAGG + Intergenic
1189518337 X:41738750-41738772 GAAGCTAGGGATCAGGAGGAAGG + Intronic
1189619345 X:42818840-42818862 AAGTCGAAGGGTGAGGAGGATGG + Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190498829 X:51055271-51055293 TAGGCTCCTGATCAGGAGGAGGG - Intergenic
1190772286 X:53525406-53525428 TAGGCTGAAGAGGAAGAGGAGGG - Intergenic
1190827614 X:54032035-54032057 TAGACTAAAGGTGAGGAGCAAGG - Intronic
1192350799 X:70354857-70354879 TGGGGCCAGGATGAGGAGGAAGG + Intronic
1192623957 X:72708588-72708610 TAGACTAAGGTTGAGGCAGAAGG + Intronic
1192911018 X:75604412-75604434 TAGGCAAAGGATGACAAAGAGGG - Intergenic
1194619973 X:96158974-96158996 TAGGCCAAGGAAGAAGAAGAAGG - Intergenic
1195309827 X:103621390-103621412 TTGGCTAGGGTTGGGGAGGATGG + Intronic
1195455505 X:105064763-105064785 TAGGCTGAGGAGGAGGAAAAGGG + Intronic
1196469309 X:116007841-116007863 AAGGCTCAGGGTTAGGAGGATGG + Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197259986 X:124307142-124307164 TAGGGGAAGGATGTGGAGCATGG - Intronic
1197485512 X:127045535-127045557 TTGGCCAGGGGTGAGGAGGAGGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197938413 X:131763722-131763744 TAGGGCAAGGATGAGCAGCATGG + Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1199706190 X:150427565-150427587 TAGGGTGAGGATGAGGAGACAGG - Intronic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200162395 X:154016271-154016293 TAGGTGCAGGGTGAGGAGGAGGG + Intronic
1201684060 Y:16681902-16681924 CACACTAATGATGAGGAGGAAGG - Intergenic