ID: 1033713724

View in Genome Browser
Species Human (GRCh38)
Location 7:143977499-143977521
Sequence TGCCTAGCCAAGAGTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033713723_1033713724 -6 Left 1033713723 7:143977482-143977504 CCATGAACTTTGGACTTTGCCTA No data
Right 1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG No data
1033713721_1033713724 -4 Left 1033713721 7:143977480-143977502 CCCCATGAACTTTGGACTTTGCC No data
Right 1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG No data
1033713718_1033713724 12 Left 1033713718 7:143977464-143977486 CCTAATATTCTTTCCACCCCATG No data
Right 1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG No data
1033713722_1033713724 -5 Left 1033713722 7:143977481-143977503 CCCATGAACTTTGGACTTTGCCT No data
Right 1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG No data
1033713720_1033713724 -1 Left 1033713720 7:143977477-143977499 CCACCCCATGAACTTTGGACTTT No data
Right 1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033713724 Original CRISPR TGCCTAGCCAAGAGTGCTTC AGG Intergenic
No off target data available for this crispr