ID: 1033713934

View in Genome Browser
Species Human (GRCh38)
Location 7:143980264-143980286
Sequence CTGGGCCCCTTGCATGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033713931_1033713934 -2 Left 1033713931 7:143980243-143980265 CCTTGTGTTGGTCTTGGCTTACT No data
Right 1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG No data
1033713925_1033713934 20 Left 1033713925 7:143980221-143980243 CCTGATCCCTGGAAGTTGGCCAC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG No data
1033713926_1033713934 14 Left 1033713926 7:143980227-143980249 CCCTGGAAGTTGGCCACCTTGTG No data
Right 1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG No data
1033713927_1033713934 13 Left 1033713927 7:143980228-143980250 CCTGGAAGTTGGCCACCTTGTGT No data
Right 1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG No data
1033713930_1033713934 1 Left 1033713930 7:143980240-143980262 CCACCTTGTGTTGGTCTTGGCTT No data
Right 1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033713934 Original CRISPR CTGGGCCCCTTGCATGAGAT AGG Intergenic
No off target data available for this crispr