ID: 1033714165

View in Genome Browser
Species Human (GRCh38)
Location 7:143982157-143982179
Sequence CAGAACAAGGATCAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033714165_1033714168 1 Left 1033714165 7:143982157-143982179 CCTGACTCCTGATCCTTGTTCTG No data
Right 1033714168 7:143982181-143982203 CTCTCACTGCCTGTGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033714165 Original CRISPR CAGAACAAGGATCAGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr