ID: 1033714535

View in Genome Browser
Species Human (GRCh38)
Location 7:143986036-143986058
Sequence GTGTGTCAACAAAAGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033714535_1033714538 -5 Left 1033714535 7:143986036-143986058 CCTTCTGGCTTTTGTTGACACAC 0: 1
1: 0
2: 1
3: 23
4: 172
Right 1033714538 7:143986054-143986076 CACACAGCAAGGCCTTCTATGGG 0: 1
1: 0
2: 1
3: 14
4: 263
1033714535_1033714537 -6 Left 1033714535 7:143986036-143986058 CCTTCTGGCTTTTGTTGACACAC 0: 1
1: 0
2: 1
3: 23
4: 172
Right 1033714537 7:143986053-143986075 ACACACAGCAAGGCCTTCTATGG 0: 1
1: 0
2: 0
3: 22
4: 250
1033714535_1033714540 23 Left 1033714535 7:143986036-143986058 CCTTCTGGCTTTTGTTGACACAC 0: 1
1: 0
2: 1
3: 23
4: 172
Right 1033714540 7:143986082-143986104 CAGCCAACACAAAGCAGATAAGG 0: 1
1: 0
2: 0
3: 19
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033714535 Original CRISPR GTGTGTCAACAAAAGCCAGA AGG (reversed) Intergenic
902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG + Intergenic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
904343650 1:29854077-29854099 GTGTGTTAGCACTAGCCAGAGGG + Intergenic
905094880 1:35461540-35461562 TTGTGTAAACACAAGACAGAAGG + Intronic
905861917 1:41357715-41357737 GAGTGTCTGCAGAAGCCAGAGGG - Intergenic
907382215 1:54100563-54100585 ATGTTTGAACCAAAGCCAGAAGG + Intronic
911290362 1:96050181-96050203 GTGAGTCAGCAAAAACTAGAAGG + Intergenic
912410362 1:109476978-109477000 GTGAGTCAGCACAGGCCAGAAGG + Intronic
914418820 1:147509633-147509655 GTGCTGCAACAGAAGCCAGAAGG - Intergenic
914686442 1:149984084-149984106 GTGTTTCAATAAAAGCAAGGTGG - Intronic
915651247 1:157312497-157312519 GTGAGTCACCAAGTGCCAGATGG + Intergenic
916076163 1:161201064-161201086 GTGTTTCAACAATAGAAAGAAGG + Intronic
917489230 1:175483540-175483562 CTGTGTAAATACAAGCCAGAAGG + Intronic
918753632 1:188306847-188306869 GTGTGCCAACAAATGCCCAAAGG - Intergenic
922861879 1:228825997-228826019 GGGTGTCAACAGAGGCCAAATGG - Intergenic
924702652 1:246469355-246469377 ATATGTCAACAAAAGCTAAAGGG + Intronic
1062851074 10:743987-744009 CAGTGGCAACAACAGCCAGAAGG + Intergenic
1062931555 10:1356243-1356265 GTGTGGCCACAAAACCCAGAAGG + Intronic
1064766726 10:18682888-18682910 ATGTGTTGACAGAAGCCAGATGG - Intergenic
1067483628 10:46624172-46624194 CTTGCTCAACAAAAGCCAGAGGG - Intergenic
1067542514 10:47166215-47166237 GTGTGTGAGCAAAAGCCAGAAGG + Intergenic
1067611128 10:47717471-47717493 CTTGCTCAACAAAAGCCAGAGGG + Intergenic
1068073441 10:52224392-52224414 GTGTGGGAACAAAAACCAGAGGG - Intronic
1069184397 10:65404856-65404878 GTGTGTCAGGAAAAGGCACAAGG + Intergenic
1069273615 10:66562362-66562384 GTGTGTGAACATCAGCCAGTTGG - Intronic
1070278057 10:75026798-75026820 GTGTTCCAACAAAAGCCGGTAGG + Intronic
1070781202 10:79138329-79138351 GTGGGTCCACAGAGGCCAGAAGG - Intronic
1071626546 10:87177708-87177730 CTTGCTCAACAAAAGCCAGAGGG + Intronic
1073254772 10:102143721-102143743 GTGTGGCAACTAAAGGCAGAGGG + Intronic
1073578796 10:104645264-104645286 GTGTTTCAAAAACACCCAGAGGG + Intronic
1073732240 10:106303013-106303035 GTGGGTGAACAAAAGACACAGGG - Intergenic
1074974989 10:118572783-118572805 GAGTGTCAACAGAGGCCAAATGG + Intergenic
1077838675 11:5948120-5948142 GTGTGAGGACAAAAACCAGAAGG - Exonic
1079344166 11:19637430-19637452 GTGTGTCAACATTGGCAAGATGG - Intronic
1079554550 11:21742403-21742425 GTGTGTTAACAAAAGCAAAGGGG - Intergenic
1081255285 11:40885461-40885483 ATGTCTCAACATAAGCCACAGGG - Intronic
1088097594 11:106118152-106118174 GTGTGTGAATAACAGCAAGAAGG - Intergenic
1089613953 11:119684844-119684866 TTCTGTCAGCAAAACCCAGAGGG + Intronic
1090596385 11:128325064-128325086 GTGTGCCAACAAAAAACAAAAGG + Intergenic
1092222932 12:6727722-6727744 TAGTGTAAACAAAAGCCTGAAGG + Intronic
1093221978 12:16432613-16432635 GTGTGACAATAAAAGCAAGAGGG - Intronic
1093388604 12:18589505-18589527 GTGTGTTAACAAGAGGTAGAGGG + Intronic
1093519947 12:20037170-20037192 GTATGTCAACAAAAAAGAGAAGG + Intergenic
1093742697 12:22706425-22706447 GTGGGGCAACAAAAGGAAGAAGG + Intergenic
1094094773 12:26691284-26691306 GTTTATAAACAAAAGCCACAAGG - Intronic
1097036699 12:56129037-56129059 GAGTGGCACCAAAAGCAAGAGGG - Intronic
1102874960 12:116442127-116442149 GAGTCTCAAAAAAAGCCAGGGGG + Intergenic
1103102903 12:118195662-118195684 GTGTGGCAACACTAGCCAGGGGG + Intronic
1103716131 12:122946385-122946407 GTGTGTCAAATTGAGCCAGAAGG - Intronic
1103739218 12:123080203-123080225 ATGTGACAACAATAGCCAAAAGG - Intronic
1104159813 12:126167587-126167609 TTGTGTCAACAGATGACAGAGGG + Intergenic
1104804306 12:131575325-131575347 GTGGGTCACCAAAGGCCACAGGG + Intergenic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1109339708 13:61040228-61040250 GTGCATCAGCAAAAGACAGAAGG - Intergenic
1113352981 13:109547699-109547721 GTGAGTGAACAAAGGCCAGAGGG - Intergenic
1114926753 14:27411194-27411216 GTGTCTCAACAAATTCCAGATGG + Intergenic
1115617058 14:35105629-35105651 GTGTCTCAACAAAAACTATATGG + Intronic
1115713733 14:36078692-36078714 GTGTGTCTTGAAAAGCCAAAAGG + Intergenic
1117008474 14:51446429-51446451 GTGTGTCTACACAAGAGAGAAGG - Intergenic
1117854603 14:60015492-60015514 GGTTGTCAACAGAAGCCAAATGG - Intronic
1118465402 14:66026004-66026026 CTATGTCAACAAAACCCAAAGGG + Intergenic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1127050803 15:55081440-55081462 GGGTGTCAACAGAGGCCAGGTGG + Intergenic
1128913856 15:71541910-71541932 GTGTGTGAACACAAGACAGGAGG + Intronic
1134377795 16:13694144-13694166 GAGTGTCCTCAAAAGCCAAAGGG + Intergenic
1135958129 16:26973449-26973471 GTGTTTCAAGAAAGGCCAGATGG - Intergenic
1137601193 16:49757594-49757616 GGGTGTCCACAATAGCCTGAGGG - Intronic
1138319277 16:56098194-56098216 GTGGTTCCACACAAGCCAGAAGG + Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1141394315 16:83691346-83691368 GGGTGTCATCAACATCCAGATGG + Intronic
1144142517 17:12363330-12363352 GTTTTTGAACAAATGCCAGATGG + Intergenic
1145105445 17:20111680-20111702 GTGTGTCCCCAAAAGCAGGAAGG + Intronic
1147534152 17:41307825-41307847 TTGTGTCAACACAATCCAGTTGG + Exonic
1149580708 17:57748657-57748679 GCTTGCCAGCAAAAGCCAGATGG + Intergenic
1150387941 17:64775381-64775403 GTGTGTAGACAACAGACAGAAGG - Intergenic
1152002911 17:77657914-77657936 GTGTGTCAACAATAGGAAGCAGG - Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1156507447 18:37607154-37607176 GCGTGTCAAGAAAAGCCTCAGGG + Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1159790317 18:72771170-72771192 TTATGTGAACAAAAGGCAGATGG + Intronic
1159980716 18:74776191-74776213 ATGTGTCCACACAAGGCAGAAGG - Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1162813585 19:13179825-13179847 GTGTCTCAAAAAAAACCACAGGG + Intergenic
1165814938 19:38636157-38636179 GTGGGGCAACAGAAGCCAAAGGG - Intronic
1166248440 19:41547797-41547819 TTTTGTCATCAAAAGCCAGCTGG + Intergenic
925815684 2:7746037-7746059 GCATGTCAAAATAAGCCAGATGG + Intergenic
927223257 2:20735763-20735785 GGGTGTCAACAGAAGTCAAATGG - Intronic
928216975 2:29369971-29369993 GTGTGTCAACTAATGCACGAGGG - Intronic
929809724 2:45179588-45179610 TTGTGTCACCAACAGCCACATGG - Intergenic
929995798 2:46825658-46825680 GTTTGTCAAGAAGAGTCAGATGG - Intronic
930680200 2:54249539-54249561 GCGTTTAAAGAAAAGCCAGAGGG + Intronic
930805888 2:55489844-55489866 GTGACTCAGAAAAAGCCAGATGG - Intergenic
930917714 2:56714095-56714117 GTGTGTGAATAATAGCCTGATGG - Intergenic
931290492 2:60869019-60869041 GTGTGTCATCACATGGCAGAAGG + Intergenic
932171418 2:69560492-69560514 GTGTTTCAAAAAATGCCAGTAGG - Intronic
932412558 2:71555916-71555938 GTGTGTCACCACAGGGCAGAGGG - Intronic
933344894 2:81070998-81071020 CTGTAACAACAAAAGTCAGATGG + Intergenic
933494072 2:83025597-83025619 ATGTGTCAACAAAAGTCAAAAGG + Intergenic
935521990 2:104118845-104118867 GTGTGTGATCAAAGGACAGAAGG + Intergenic
937420228 2:121747956-121747978 GGGTGTCAACAGAGGCCAAATGG + Intronic
938648797 2:133358761-133358783 GGCTGTTAACAAAAGCCATATGG + Intronic
940370435 2:152895373-152895395 TTGTGCCAACAAAAGACATAAGG + Intergenic
943786542 2:191883793-191883815 GGATCTCAACAAAAGCAAGAAGG - Intergenic
947856875 2:233330098-233330120 GTGTGGGAACAACAGGCAGAAGG - Intronic
948474886 2:238211045-238211067 GTGAGTCCACAGAACCCAGAGGG - Intergenic
948895962 2:240926976-240926998 GTGTGAGAACAAATGCCAGAAGG + Intronic
1168812491 20:713856-713878 GTATGACAACAACAGCAAGAAGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169386627 20:5155522-5155544 GAATGCCAACAGAAGCCAGAAGG - Intronic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1171192037 20:23165616-23165638 GTGTGCAAACAAAAGAGAGAAGG + Intergenic
1171238153 20:23544635-23544657 GTGGGTCAACAGAGGCCAGATGG - Intergenic
1173169481 20:40712410-40712432 GAGTGGAAACAAAAGCCTGATGG - Intergenic
1173509121 20:43612341-43612363 GTATGACAACAAAAGTCATAGGG + Intronic
1178296986 21:31418373-31418395 GTGTCTAAACAGTAGCCAGAGGG - Intronic
1184197602 22:42940792-42940814 GTCTGTCAAGAATAGCCAAAGGG + Intronic
1184268813 22:43365845-43365867 GTGGGTGAACAAAGGCCAGCAGG + Intergenic
949282675 3:2364536-2364558 TATTGTCAACAAATGCCAGAAGG - Intronic
951039096 3:17968280-17968302 GAGTGTAAACAAATGTCAGAAGG - Intronic
951624847 3:24648017-24648039 GAGTGTCAAGAAGAACCAGAGGG - Intergenic
952137947 3:30444828-30444850 GTGTGTCAAAAAGAACCACAAGG - Intergenic
954284622 3:49610042-49610064 GTGTGTAGAGGAAAGCCAGATGG + Intronic
955606371 3:60709359-60709381 GTGTGCCAAGAAAATCTAGAAGG + Intronic
956072272 3:65466430-65466452 CGGTGTCAACAAAAGCCAAATGG - Intronic
960393597 3:117109126-117109148 GGCTGACAACAAAAGCCAGGAGG + Intronic
960829952 3:121835456-121835478 CTGTGGGAACAAAACCCAGAGGG - Intronic
963009829 3:140758829-140758851 GTATGTGAACAAAAGTCAAACGG - Intergenic
963500921 3:146125055-146125077 GTGCATCAACAAATGCCAAAAGG + Intronic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
964380148 3:156090540-156090562 GTACCTCAACAAAAGGCAGAGGG - Intronic
965207166 3:165735962-165735984 CTGTACAAACAAAAGCCAGAAGG + Intergenic
965964663 3:174472484-174472506 GAGTGTCAACAAAAGAGGGAGGG + Intronic
966216559 3:177508863-177508885 GGGGGTCAACACAAGGCAGAGGG - Intergenic
966902152 3:184494275-184494297 GGATGTGAACAAAAGCGAGATGG - Intronic
967146255 3:186608820-186608842 GCCTGTCAGCAAAAGCCAGAAGG - Intergenic
967556986 3:190871635-190871657 GTGTTCCATCAAAGGCCAGATGG + Intronic
967932885 3:194703110-194703132 GTGTGCAAACACAAGTCAGACGG - Intergenic
973639353 4:52887655-52887677 GCGTGGCCACCAAAGCCAGAAGG + Intronic
976379511 4:84383387-84383409 TTGTGTCAGCAAAAGCTTGATGG + Intergenic
977916530 4:102600506-102600528 GTGTGTCAGGAAAAGTCAGGGGG + Intronic
979024648 4:115553579-115553601 TTCTGCCAACAGAAGCCAGAGGG + Intergenic
979592904 4:122501090-122501112 GTGAGTAAACAAAAGCTATAAGG - Intergenic
983450556 4:167906172-167906194 GTGAGTTAAAAAAATCCAGAGGG + Intergenic
984194565 4:176642853-176642875 GGGTGTCAACAGAAGTCAGCTGG + Intergenic
989970791 5:50521654-50521676 GTGTGTCTAAAAATGTCAGATGG + Intergenic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
993548876 5:89249020-89249042 GTTTGCCAAGAAAAGCAAGAAGG + Intergenic
999009934 5:148025039-148025061 GTGCCTCAATAAAATCCAGAGGG + Intergenic
1004403263 6:15308310-15308332 GTGTGGAAATAGAAGCCAGAGGG + Intronic
1004605191 6:17188276-17188298 TTCTGTCAACAAGAGACAGAAGG + Intergenic
1007391911 6:41554270-41554292 GTGGGTCAACAAAACTCAGCAGG - Intronic
1007800290 6:44386614-44386636 GTGTGTAAATAAAAGCTAAAAGG + Intergenic
1010914021 6:81593604-81593626 GTGAGTGAAGAATAGCCAGAAGG + Intronic
1012419680 6:99050768-99050790 GTATGTCAACAATAGCGTGATGG + Intergenic
1014914602 6:127130918-127130940 GTGTGTGAATTAAAGTCAGAGGG - Intronic
1016209166 6:141507146-141507168 GGGTGTTAGCAAAAGCCTGAGGG - Intergenic
1017599248 6:156062812-156062834 GTCTGTGGACACAAGCCAGAAGG + Intergenic
1018434927 6:163751178-163751200 GTGTTCCAAGAAAAGCCACAAGG - Intergenic
1022519193 7:30994911-30994933 GTGTGCCAACAAATGCCATATGG - Intergenic
1023644849 7:42300007-42300029 GTGGCTCAACAAAAGCCAGTTGG - Intergenic
1024355003 7:48405323-48405345 GGGTGTCAACCAAAACCACATGG - Intronic
1028840224 7:95421471-95421493 GTCACTCAGCAAAAGCCAGATGG - Intronic
1030314906 7:108104582-108104604 GTGTGTCAGCACAATACAGATGG - Exonic
1030950484 7:115785158-115785180 GTATTTCTACAAAAGGCAGAGGG + Intergenic
1032509794 7:132463680-132463702 GTGTGTCCCCGTAAGCCAGAGGG - Intronic
1033714535 7:143986036-143986058 GTGTGTCAACAAAAGCCAGAAGG - Intergenic
1034287639 7:149899025-149899047 GAGTGTCAACAAAGGCCAAAAGG + Intergenic
1034663489 7:152793897-152793919 GAGTGTCAACAAAGGCCAAAAGG - Intronic
1035923319 8:3701838-3701860 GAGCCACAACAAAAGCCAGAGGG + Intronic
1037727046 8:21491435-21491457 GTCTGTCAACAGAAGCCACTGGG - Intergenic
1039061946 8:33578942-33578964 GTGTTTCAATAAAAGGAAGAAGG + Intergenic
1042408598 8:68435411-68435433 GGGTATCACCAAAAGTCAGAGGG + Intronic
1043303926 8:78770155-78770177 CAGTGGCAACAAAAGCCAAATGG + Intronic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1045631214 8:104125317-104125339 GGGTTTCAACAAAAGCAACATGG - Intronic
1050252266 9:3757444-3757466 GCATTTCAACAAAGGCCAGAAGG + Intergenic
1051497710 9:17743553-17743575 GTGTGTTCACAAAAGAGAGAGGG - Intronic
1052690881 9:31815523-31815545 GTGTGTCACCTAAGGCCAGATGG - Intergenic
1055716072 9:79119781-79119803 ATGTGACAAGAAAAGCCAGAAGG - Intergenic
1056844693 9:90027041-90027063 GTTTGTGAACAGAAGTCAGAAGG + Intergenic
1058624475 9:106920392-106920414 ATGTGTACACAAAAGCAAGATGG + Intronic
1058667598 9:107334742-107334764 GTGTGCAAACAAAACCCATATGG - Intergenic
1061369593 9:130191018-130191040 GTGTCTGAATAAAAGTCAGAGGG - Intronic
1186030409 X:5362813-5362835 TTGTGTCCACAAAAGTCACAGGG - Intergenic
1188958420 X:36462140-36462162 ATGTGTCAAGAAAAGCTAGAAGG + Intergenic
1192949571 X:76003000-76003022 GTGTGTCATCAAATGTGAGATGG + Intergenic
1196047318 X:111269951-111269973 GTGGGTCAGCAGAAGCTAGAAGG + Intronic
1196197661 X:112852918-112852940 AAGTGTCCACAAAAGCCAAAAGG - Intergenic
1196869298 X:120097685-120097707 GTGTGTCTGCAAAAGAGAGAAGG + Intergenic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1199943189 X:152643651-152643673 GGGTGTGAACAAAAGCTAGGAGG + Intronic
1201432845 Y:13922642-13922664 GTGTGTCTAAAAATGTCAGATGG + Intergenic
1202024135 Y:20502247-20502269 GTGTGTCAAGAAATGCCATCTGG + Intergenic
1202270763 Y:23071999-23072021 GTGTCTTAACAAAACCCAGAAGG + Intergenic
1202295263 Y:23348683-23348705 GTGTCTTAACAAAACCCAGAAGG - Intergenic
1202423758 Y:24705743-24705765 GTGTCTTAACAAAACCCAGAAGG + Intergenic
1202447031 Y:24964342-24964364 GTGTCTTAACAAAACCCAGAAGG - Intergenic