ID: 1033714805

View in Genome Browser
Species Human (GRCh38)
Location 7:143989221-143989243
Sequence TTCCTATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033714805_1033714809 8 Left 1033714805 7:143989221-143989243 CCAGCACTCCCTCAACATAGGAA No data
Right 1033714809 7:143989252-143989274 ACAAATTTTCTTTTCTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033714805 Original CRISPR TTCCTATGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr