ID: 1033718280

View in Genome Browser
Species Human (GRCh38)
Location 7:144026274-144026296
Sequence CCCTCTTTATTCTATCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033718280_1033718285 17 Left 1033718280 7:144026274-144026296 CCAATTTGATAGAATAAAGAGGG No data
Right 1033718285 7:144026314-144026336 TCTCTCTCTTTCCTAGAGCTGGG No data
1033718280_1033718284 16 Left 1033718280 7:144026274-144026296 CCAATTTGATAGAATAAAGAGGG No data
Right 1033718284 7:144026313-144026335 CTCTCTCTCTTTCCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033718280 Original CRISPR CCCTCTTTATTCTATCAAAT TGG (reversed) Intergenic
No off target data available for this crispr