ID: 1033719155

View in Genome Browser
Species Human (GRCh38)
Location 7:144038587-144038609
Sequence AAATTCCATCAGATATATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033719155_1033719157 8 Left 1033719155 7:144038587-144038609 CCAAGATATATCTGATGGAATTT No data
Right 1033719157 7:144038618-144038640 GGCTTCAGCTCATTATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033719155 Original CRISPR AAATTCCATCAGATATATCT TGG (reversed) Intergenic
No off target data available for this crispr