ID: 1033721446

View in Genome Browser
Species Human (GRCh38)
Location 7:144063112-144063134
Sequence CAATTTTAAAAACATGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033721444_1033721446 -6 Left 1033721444 7:144063095-144063117 CCCAGAGAATAAGAAAGCAATTT No data
Right 1033721446 7:144063112-144063134 CAATTTTAAAAACATGTACCTGG No data
1033721442_1033721446 14 Left 1033721442 7:144063075-144063097 CCAATAGAAATTACCGTAAACCC No data
Right 1033721446 7:144063112-144063134 CAATTTTAAAAACATGTACCTGG No data
1033721443_1033721446 1 Left 1033721443 7:144063088-144063110 CCGTAAACCCAGAGAATAAGAAA No data
Right 1033721446 7:144063112-144063134 CAATTTTAAAAACATGTACCTGG No data
1033721445_1033721446 -7 Left 1033721445 7:144063096-144063118 CCAGAGAATAAGAAAGCAATTTT No data
Right 1033721446 7:144063112-144063134 CAATTTTAAAAACATGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033721446 Original CRISPR CAATTTTAAAAACATGTACC TGG Intergenic
No off target data available for this crispr