ID: 1033728088

View in Genome Browser
Species Human (GRCh38)
Location 7:144142879-144142901
Sequence CTGAGGAATGCTCAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033728078_1033728088 26 Left 1033728078 7:144142830-144142852 CCTGTTTCACAGTGTCTTGAACC No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728080_1033728088 4 Left 1033728080 7:144142852-144142874 CCAATTCTGAACCCCCTGATCTA No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728083_1033728088 -8 Left 1033728083 7:144142864-144142886 CCCCTGATCTACAGTCTGAGGAA No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728077_1033728088 27 Left 1033728077 7:144142829-144142851 CCCTGTTTCACAGTGTCTTGAAC No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728082_1033728088 -7 Left 1033728082 7:144142863-144142885 CCCCCTGATCTACAGTCTGAGGA No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728085_1033728088 -10 Left 1033728085 7:144142866-144142888 CCTGATCTACAGTCTGAGGAATG No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728079_1033728088 5 Left 1033728079 7:144142851-144142873 CCCAATTCTGAACCCCCTGATCT No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data
1033728084_1033728088 -9 Left 1033728084 7:144142865-144142887 CCCTGATCTACAGTCTGAGGAAT No data
Right 1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033728088 Original CRISPR CTGAGGAATGCTCAGGTGAA GGG Intergenic
No off target data available for this crispr