ID: 1033728861

View in Genome Browser
Species Human (GRCh38)
Location 7:144153027-144153049
Sequence TGGTACACAAACTTTAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033728861_1033728866 27 Left 1033728861 7:144153027-144153049 CCTAACTTAAAGTTTGTGTACCA No data
Right 1033728866 7:144153077-144153099 CCCCACTCCCACCCAGCTCTGGG No data
1033728861_1033728869 30 Left 1033728861 7:144153027-144153049 CCTAACTTAAAGTTTGTGTACCA No data
Right 1033728869 7:144153080-144153102 CACTCCCACCCAGCTCTGGGAGG No data
1033728861_1033728864 26 Left 1033728861 7:144153027-144153049 CCTAACTTAAAGTTTGTGTACCA No data
Right 1033728864 7:144153076-144153098 ACCCCACTCCCACCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033728861 Original CRISPR TGGTACACAAACTTTAAGTT AGG (reversed) Intergenic
No off target data available for this crispr