ID: 1033735642

View in Genome Browser
Species Human (GRCh38)
Location 7:144218870-144218892
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735642_1033735650 -6 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735650 7:144218887-144218909 GTGGAAGTGTGGGTGGCCATGGG No data
1033735642_1033735657 26 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735642_1033735652 10 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735652 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
1033735642_1033735655 17 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735655 7:144218910-144218932 AGCTGCATTTCCATGGTGGTGGG No data
1033735642_1033735653 13 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735642_1033735656 25 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735656 7:144218918-144218940 TTCCATGGTGGTGGGAGCTCTGG No data
1033735642_1033735649 -7 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735649 7:144218886-144218908 GGTGGAAGTGTGGGTGGCCATGG No data
1033735642_1033735654 16 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735654 7:144218909-144218931 GAGCTGCATTTCCATGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735642 Original CRISPR TTCCACCCAGGGGCAGCTCA AGG (reversed) Intergenic