ID: 1033735645

View in Genome Browser
Species Human (GRCh38)
Location 7:144218880-144218902
Sequence CCACCCACACTTCCACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735645_1033735652 0 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735652 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
1033735645_1033735655 7 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735655 7:144218910-144218932 AGCTGCATTTCCATGGTGGTGGG No data
1033735645_1033735656 15 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735656 7:144218918-144218940 TTCCATGGTGGTGGGAGCTCTGG No data
1033735645_1033735654 6 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735654 7:144218909-144218931 GAGCTGCATTTCCATGGTGGTGG No data
1033735645_1033735657 16 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735645_1033735653 3 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735645 Original CRISPR CCACCCACACTTCCACCCAG GGG (reversed) Intergenic