ID: 1033735647

View in Genome Browser
Species Human (GRCh38)
Location 7:144218881-144218903
Sequence GCCACCCACACTTCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735647_1033735653 2 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735647_1033735656 14 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735656 7:144218918-144218940 TTCCATGGTGGTGGGAGCTCTGG No data
1033735647_1033735655 6 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735655 7:144218910-144218932 AGCTGCATTTCCATGGTGGTGGG No data
1033735647_1033735652 -1 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735652 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
1033735647_1033735657 15 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735647_1033735654 5 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735654 7:144218909-144218931 GAGCTGCATTTCCATGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735647 Original CRISPR GCCACCCACACTTCCACCCA GGG (reversed) Intergenic