ID: 1033735648

View in Genome Browser
Species Human (GRCh38)
Location 7:144218882-144218904
Sequence GGCCACCCACACTTCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735648_1033735653 1 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735648_1033735654 4 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735654 7:144218909-144218931 GAGCTGCATTTCCATGGTGGTGG No data
1033735648_1033735657 14 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735648_1033735656 13 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735656 7:144218918-144218940 TTCCATGGTGGTGGGAGCTCTGG No data
1033735648_1033735655 5 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735655 7:144218910-144218932 AGCTGCATTTCCATGGTGGTGGG No data
1033735648_1033735652 -2 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735652 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735648 Original CRISPR GGCCACCCACACTTCCACCC AGG (reversed) Intergenic