ID: 1033735651

View in Genome Browser
Species Human (GRCh38)
Location 7:144218903-144218925
Sequence CCATGGAAATGCAGCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735651_1033735656 -8 Left 1033735651 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
Right 1033735656 7:144218918-144218940 TTCCATGGTGGTGGGAGCTCTGG No data
1033735651_1033735657 -7 Left 1033735651 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735651 Original CRISPR CCATGGAAATGCAGCTCCCA TGG (reversed) Intergenic