ID: 1033735653

View in Genome Browser
Species Human (GRCh38)
Location 7:144218906-144218928
Sequence TGGGAGCTGCATTTCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735647_1033735653 2 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735642_1033735653 13 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735645_1033735653 3 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data
1033735648_1033735653 1 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735653 7:144218906-144218928 TGGGAGCTGCATTTCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735653 Original CRISPR TGGGAGCTGCATTTCCATGG TGG Intergenic