ID: 1033735657

View in Genome Browser
Species Human (GRCh38)
Location 7:144218919-144218941
Sequence TCCATGGTGGTGGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033735651_1033735657 -7 Left 1033735651 7:144218903-144218925 CCATGGGAGCTGCATTTCCATGG No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735648_1033735657 14 Left 1033735648 7:144218882-144218904 CCTGGGTGGAAGTGTGGGTGGCC No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735647_1033735657 15 Left 1033735647 7:144218881-144218903 CCCTGGGTGGAAGTGTGGGTGGC No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735642_1033735657 26 Left 1033735642 7:144218870-144218892 CCTTGAGCTGCCCCTGGGTGGAA No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data
1033735645_1033735657 16 Left 1033735645 7:144218880-144218902 CCCCTGGGTGGAAGTGTGGGTGG No data
Right 1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033735657 Original CRISPR TCCATGGTGGTGGGAGCTCT GGG Intergenic