ID: 1033737191

View in Genome Browser
Species Human (GRCh38)
Location 7:144234177-144234199
Sequence CTCCAATGACAGCTGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033737191_1033737198 21 Left 1033737191 7:144234177-144234199 CCCTGGTCCAGCTGTCATTGGAG No data
Right 1033737198 7:144234221-144234243 AATGTCCACCAACGATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033737191 Original CRISPR CTCCAATGACAGCTGGACCA GGG (reversed) Intergenic
No off target data available for this crispr