ID: 1033737520

View in Genome Browser
Species Human (GRCh38)
Location 7:144237944-144237966
Sequence ATAGTACCTATTTTATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033737515_1033737520 20 Left 1033737515 7:144237901-144237923 CCTCTCCAAACTCGTTTCCTCTT No data
Right 1033737520 7:144237944-144237966 ATAGTACCTATTTTATGAGGTGG No data
1033737518_1033737520 3 Left 1033737518 7:144237918-144237940 CCTCTTTTTTAAAAAGGAGAAAA No data
Right 1033737520 7:144237944-144237966 ATAGTACCTATTTTATGAGGTGG No data
1033737516_1033737520 15 Left 1033737516 7:144237906-144237928 CCAAACTCGTTTCCTCTTTTTTA No data
Right 1033737520 7:144237944-144237966 ATAGTACCTATTTTATGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033737520 Original CRISPR ATAGTACCTATTTTATGAGG TGG Intergenic
No off target data available for this crispr