ID: 1033739207

View in Genome Browser
Species Human (GRCh38)
Location 7:144256400-144256422
Sequence GGGTGTCCAAAATGTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033739203_1033739207 10 Left 1033739203 7:144256367-144256389 CCCTCTAAGGTTAGAGAGGCAGA No data
Right 1033739207 7:144256400-144256422 GGGTGTCCAAAATGTCCCAGTGG No data
1033739204_1033739207 9 Left 1033739204 7:144256368-144256390 CCTCTAAGGTTAGAGAGGCAGAG No data
Right 1033739207 7:144256400-144256422 GGGTGTCCAAAATGTCCCAGTGG No data
1033739201_1033739207 18 Left 1033739201 7:144256359-144256381 CCAAGGGACCCTCTAAGGTTAGA No data
Right 1033739207 7:144256400-144256422 GGGTGTCCAAAATGTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033739207 Original CRISPR GGGTGTCCAAAATGTCCCAG TGG Intergenic
No off target data available for this crispr