ID: 1033742344

View in Genome Browser
Species Human (GRCh38)
Location 7:144284713-144284735
Sequence TGGGAACCACTACACGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033742335_1033742344 23 Left 1033742335 7:144284667-144284689 CCTGAACCTAGGGCCAATGGAGG No data
Right 1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG No data
1033742339_1033742344 17 Left 1033742339 7:144284673-144284695 CCTAGGGCCAATGGAGGAGGGTG No data
Right 1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG No data
1033742334_1033742344 24 Left 1033742334 7:144284666-144284688 CCCTGAACCTAGGGCCAATGGAG No data
Right 1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG No data
1033742341_1033742344 10 Left 1033742341 7:144284680-144284702 CCAATGGAGGAGGGTGGCTATGC No data
Right 1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033742344 Original CRISPR TGGGAACCACTACACGAGCA TGG Intergenic
No off target data available for this crispr