ID: 1033742351

View in Genome Browser
Species Human (GRCh38)
Location 7:144284741-144284763
Sequence TGTCTCCACCACGGAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033742345_1033742351 -1 Left 1033742345 7:144284719-144284741 CCACTACACGAGCATGGCCATCT No data
Right 1033742351 7:144284741-144284763 TGTCTCCACCACGGAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033742351 Original CRISPR TGTCTCCACCACGGAGGGAT GGG Intergenic
No off target data available for this crispr