ID: 1033742358

View in Genome Browser
Species Human (GRCh38)
Location 7:144284763-144284785
Sequence GTGTCCCTCCTCTGTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033742353_1033742358 -9 Left 1033742353 7:144284749-144284771 CCACGGAGGGATGGGTGTCCCTC No data
Right 1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG No data
1033742345_1033742358 21 Left 1033742345 7:144284719-144284741 CCACTACACGAGCATGGCCATCT No data
Right 1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG No data
1033742352_1033742358 -6 Left 1033742352 7:144284746-144284768 CCACCACGGAGGGATGGGTGTCC No data
Right 1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG No data
1033742348_1033742358 4 Left 1033742348 7:144284736-144284758 CCATCTGTCTCCACCACGGAGGG No data
Right 1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033742358 Original CRISPR GTGTCCCTCCTCTGTGGGGG AGG Intergenic
No off target data available for this crispr