ID: 1033745535

View in Genome Browser
Species Human (GRCh38)
Location 7:144313013-144313035
Sequence ATAGTACCTATTTTATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033745535_1033745539 15 Left 1033745535 7:144313013-144313035 CCACCTCATAAAATAGGTACTAT No data
Right 1033745539 7:144313051-144313073 TAAAAAAGAGGAAACGAGTTTGG No data
1033745535_1033745540 20 Left 1033745535 7:144313013-144313035 CCACCTCATAAAATAGGTACTAT No data
Right 1033745540 7:144313056-144313078 AAGAGGAAACGAGTTTGGAGAGG No data
1033745535_1033745537 3 Left 1033745535 7:144313013-144313035 CCACCTCATAAAATAGGTACTAT No data
Right 1033745537 7:144313039-144313061 TTTTCTCCTTTTTAAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033745535 Original CRISPR ATAGTACCTATTTTATGAGG TGG (reversed) Intergenic
No off target data available for this crispr