ID: 1033745539

View in Genome Browser
Species Human (GRCh38)
Location 7:144313051-144313073
Sequence TAAAAAAGAGGAAACGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033745536_1033745539 12 Left 1033745536 7:144313016-144313038 CCTCATAAAATAGGTACTATCAC No data
Right 1033745539 7:144313051-144313073 TAAAAAAGAGGAAACGAGTTTGG No data
1033745535_1033745539 15 Left 1033745535 7:144313013-144313035 CCACCTCATAAAATAGGTACTAT No data
Right 1033745539 7:144313051-144313073 TAAAAAAGAGGAAACGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033745539 Original CRISPR TAAAAAAGAGGAAACGAGTT TGG Intergenic
No off target data available for this crispr