ID: 1033745540

View in Genome Browser
Species Human (GRCh38)
Location 7:144313056-144313078
Sequence AAGAGGAAACGAGTTTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033745536_1033745540 17 Left 1033745536 7:144313016-144313038 CCTCATAAAATAGGTACTATCAC No data
Right 1033745540 7:144313056-144313078 AAGAGGAAACGAGTTTGGAGAGG No data
1033745535_1033745540 20 Left 1033745535 7:144313013-144313035 CCACCTCATAAAATAGGTACTAT No data
Right 1033745540 7:144313056-144313078 AAGAGGAAACGAGTTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033745540 Original CRISPR AAGAGGAAACGAGTTTGGAG AGG Intergenic
No off target data available for this crispr