ID: 1033745866

View in Genome Browser
Species Human (GRCh38)
Location 7:144316769-144316791
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033745859_1033745866 21 Left 1033745859 7:144316725-144316747 CCAGTCTATCGTTGGTGGACATT No data
Right 1033745866 7:144316769-144316791 CTCCAATGACAGCTGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033745866 Original CRISPR CTCCAATGACAGCTGGACCA GGG Intergenic
No off target data available for this crispr