ID: 1033747395

View in Genome Browser
Species Human (GRCh38)
Location 7:144332050-144332072
Sequence TCCATGGTGGTGGGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033747395_1033747407 16 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747395_1033747401 -7 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747401 7:144332066-144332088 CCATGGAAATGCAGCTCCCATGG No data
1033747395_1033747410 26 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747410 7:144332099-144332121 TTCCACCCAGGGGCAGCTCAAGG No data
1033747395_1033747404 14 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747404 7:144332087-144332109 GGCCACCCACACTTCCACCCAGG No data
1033747395_1033747405 15 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747405 7:144332088-144332110 GCCACCCACACTTCCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033747395 Original CRISPR TCCATGGTGGTGGGAGCTCT GGG (reversed) Intergenic