ID: 1033747397

View in Genome Browser
Species Human (GRCh38)
Location 7:144332059-144332081
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033747397_1033747405 6 Left 1033747397 7:144332059-144332081 CCCACCACCATGGAAATGCAGCT No data
Right 1033747405 7:144332088-144332110 GCCACCCACACTTCCACCCAGGG No data
1033747397_1033747407 7 Left 1033747397 7:144332059-144332081 CCCACCACCATGGAAATGCAGCT No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747397_1033747410 17 Left 1033747397 7:144332059-144332081 CCCACCACCATGGAAATGCAGCT No data
Right 1033747410 7:144332099-144332121 TTCCACCCAGGGGCAGCTCAAGG No data
1033747397_1033747404 5 Left 1033747397 7:144332059-144332081 CCCACCACCATGGAAATGCAGCT No data
Right 1033747404 7:144332087-144332109 GGCCACCCACACTTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033747397 Original CRISPR AGCTGCATTTCCATGGTGGT GGG (reversed) Intergenic