ID: 1033747399

View in Genome Browser
Species Human (GRCh38)
Location 7:144332063-144332085
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033747399_1033747404 1 Left 1033747399 7:144332063-144332085 CCACCATGGAAATGCAGCTCCCA No data
Right 1033747404 7:144332087-144332109 GGCCACCCACACTTCCACCCAGG No data
1033747399_1033747407 3 Left 1033747399 7:144332063-144332085 CCACCATGGAAATGCAGCTCCCA No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747399_1033747405 2 Left 1033747399 7:144332063-144332085 CCACCATGGAAATGCAGCTCCCA No data
Right 1033747405 7:144332088-144332110 GCCACCCACACTTCCACCCAGGG No data
1033747399_1033747410 13 Left 1033747399 7:144332063-144332085 CCACCATGGAAATGCAGCTCCCA No data
Right 1033747410 7:144332099-144332121 TTCCACCCAGGGGCAGCTCAAGG 0: 2
1: 0
2: 2
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033747399 Original CRISPR TGGGAGCTGCATTTCCATGG TGG (reversed) Intergenic