ID: 1033747401

View in Genome Browser
Species Human (GRCh38)
Location 7:144332066-144332088
Sequence CCATGGAAATGCAGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033747395_1033747401 -7 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747401 7:144332066-144332088 CCATGGAAATGCAGCTCCCATGG No data
1033747396_1033747401 -8 Left 1033747396 7:144332051-144332073 CCAGAGCTCCCACCACCATGGAA No data
Right 1033747401 7:144332066-144332088 CCATGGAAATGCAGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033747401 Original CRISPR CCATGGAAATGCAGCTCCCA TGG Intergenic