ID: 1033747407

View in Genome Browser
Species Human (GRCh38)
Location 7:144332089-144332111
Sequence CCACCCACACTTCCACCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033747398_1033747407 6 Left 1033747398 7:144332060-144332082 CCACCACCATGGAAATGCAGCTC No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747395_1033747407 16 Left 1033747395 7:144332050-144332072 CCCAGAGCTCCCACCACCATGGA No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747396_1033747407 15 Left 1033747396 7:144332051-144332073 CCAGAGCTCCCACCACCATGGAA No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747397_1033747407 7 Left 1033747397 7:144332059-144332081 CCCACCACCATGGAAATGCAGCT No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747400_1033747407 0 Left 1033747400 7:144332066-144332088 CCATGGAAATGCAGCTCCCATGG No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data
1033747399_1033747407 3 Left 1033747399 7:144332063-144332085 CCACCATGGAAATGCAGCTCCCA No data
Right 1033747407 7:144332089-144332111 CCACCCACACTTCCACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033747407 Original CRISPR CCACCCACACTTCCACCCAG GGG Intergenic