ID: 1033750246

View in Genome Browser
Species Human (GRCh38)
Location 7:144355443-144355465
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 3, 1: 0, 2: 1, 3: 31, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033750237_1033750246 6 Left 1033750237 7:144355414-144355436 CCTGCGCTGGGGACGGCTCTGGG 0: 3
1: 0
2: 1
3: 30
4: 270
Right 1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG 0: 3
1: 0
2: 1
3: 31
4: 243
1033750230_1033750246 26 Left 1033750230 7:144355394-144355416 CCGCGGGTGGGGCGGCCGGGCCT 0: 2
1: 0
2: 0
3: 23
4: 196
Right 1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG 0: 3
1: 0
2: 1
3: 31
4: 243
1033750235_1033750246 11 Left 1033750235 7:144355409-144355431 CCGGGCCTGCGCTGGGGACGGCT 0: 3
1: 0
2: 0
3: 19
4: 291
Right 1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG 0: 3
1: 0
2: 1
3: 31
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900210699 1:1454493-1454515 GGCCTGCGCCGCTACCTGGATGG - Exonic
900216573 1:1485164-1485186 GGCCTGCGCCGCTACCTGGATGG - Exonic
900223653 1:1522892-1522914 GGCCTGCGCTGCTACCTGGATGG - Exonic
900342278 1:2194794-2194816 GGGCGGGGGCGGGGCCTGGAGGG - Intronic
900559574 1:3297171-3297193 AGGAGACGCCGGGACCTGGAGGG - Intronic
900593525 1:3470184-3470206 GGCTGGCCCCGAGGCCTGGAGGG + Intronic
900690796 1:3979093-3979115 GCCCGGGGCCGGGCCCTGGCGGG - Intergenic
901007980 1:6180724-6180746 GGCCGGAGCCGGGAGCGGGGTGG - Intergenic
901088364 1:6625506-6625528 GGCCAGGGCCGGGACGTGCAGGG + Intronic
903063593 1:20686112-20686134 TGTCGGCGCAGGGACCTGGGAGG + Exonic
903310651 1:22452341-22452363 GCCCGGCGAAGGGACCTGAAGGG - Intronic
903455535 1:23484335-23484357 GGCCGGAGCCTGGACCTTGGCGG - Intronic
904038391 1:27570865-27570887 GGCAGGGGCAGGGGCCTGGAGGG - Intronic
906480873 1:46198249-46198271 GGGCGGCTCCGGGCCCTGGGAGG - Intronic
907377743 1:54057775-54057797 GGCAGGCGCCAGGTCATGGAAGG - Intronic
908703927 1:66930418-66930440 GCCCGGCTCCGGGACAGGGAGGG - Intronic
914263553 1:146019408-146019430 GGCCGGAGCCCGCGCCTGGAAGG + Exonic
915839255 1:159201922-159201944 GGCTGGCGTTGGGACCAGGAAGG - Exonic
919802337 1:201361427-201361449 GGGCTGGGCCGGGACCAGGACGG - Intronic
920077517 1:203348042-203348064 GGCAGTCGCGGGGATCTGGAGGG + Exonic
921121281 1:212139875-212139897 GCCCAGCGCCAGGACATGGAGGG - Intergenic
922602882 1:226870580-226870602 GGCCGGCGCCGGGTCCGGCCGGG + Exonic
923545622 1:234921062-234921084 AGCAGGCCCTGGGACCTGGATGG - Intergenic
924436705 1:244048990-244049012 GGCCGGCGCCGGGACTCACACGG - Intronic
1063449808 10:6143986-6144008 GGCAGCCGGCGGGACGTGGAAGG + Intergenic
1064013866 10:11758110-11758132 GGCCGCCGCAGGGACCTGCTTGG + Intronic
1066065788 10:31760014-31760036 TGCCGGCCCCAGGACCTGGATGG - Intergenic
1067694206 10:48523743-48523765 GGCCAGCCCCGGGCCCTGGAGGG + Intronic
1067696857 10:48541998-48542020 GGCAGGGGCCGGGTGCTGGAGGG + Intronic
1068538537 10:58267567-58267589 GCCCGGCGCCTCGACCCGGAGGG + Exonic
1070919471 10:80175161-80175183 GGCTGGGGCCGGGACGGGGAGGG - Intronic
1073134916 10:101215144-101215166 GGCCTTCCCCAGGACCTGGAGGG + Intergenic
1076024498 10:127100662-127100684 GCCCTGCGCAGGGAGCTGGAAGG + Intronic
1076721811 10:132396443-132396465 GGCCGGCACCGGGGCCCGGGGGG - Intergenic
1076828550 10:132982867-132982889 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828562 10:132982905-132982927 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828574 10:132982943-132982965 AGGCGGCGCTGGGAGCTGGATGG - Intergenic
1077106592 11:844933-844955 GGCCAGCCACGGGACCAGGAGGG + Intronic
1077121505 11:910947-910969 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
1077352064 11:2097621-2097643 GGCAGGCGCCCGGACCTGGGTGG - Intergenic
1079034958 11:17013630-17013652 GGCGAGTGCCGGGACCTGGATGG - Intronic
1079122514 11:17695906-17695928 GGCCGGGGCCGGGGCCGGGCCGG + Intergenic
1080606651 11:33869713-33869735 TGGCGGCGGCGGGACCGGGATGG - Exonic
1082816166 11:57510858-57510880 GGCGGGCGCCTGTACCTGGGAGG + Intronic
1083185522 11:61015725-61015747 GGGCGGGGCCTGGACCTGGATGG - Exonic
1083684719 11:64369364-64369386 GGCCGGGGGCGGGGCCTGGGTGG + Intronic
1083913960 11:65727996-65728018 GGCCGGCGCCAGGTCCTGCTTGG - Intergenic
1084021916 11:66422840-66422862 GGCCAGGGCCAGGACCTGGGCGG - Exonic
1084304346 11:68271916-68271938 GCCCGGCGCGGGGACGTGGCCGG + Exonic
1084574893 11:69982737-69982759 GGCTGGAGGCTGGACCTGGAGGG + Intergenic
1089455123 11:118621472-118621494 GGGCGGGCCCGGGACCTGGAGGG + Intronic
1089527563 11:119107375-119107397 GGCCGGCACCGGCTCCGGGAGGG - Exonic
1089559986 11:119338980-119339002 GGCCGGCCCCAGGAGCAGGAGGG + Exonic
1096513555 12:52144741-52144763 GGCCGGGGCCTGGGCCTGGATGG + Intergenic
1096796757 12:54082596-54082618 GGCCGGGGCCGGGGCCGGGCTGG + Intergenic
1096803373 12:54126284-54126306 GGCGGGCCCGGGGAACTGGAGGG - Intergenic
1096807388 12:54148939-54148961 GGCAGGGGCCGGGTCCTGGAGGG - Intergenic
1097051951 12:56229048-56229070 GGCCACCACCGGGACCTGGTGGG - Exonic
1097057468 12:56258435-56258457 GGGGAGCGCCGGGACCAGGACGG - Intergenic
1097679055 12:62632236-62632258 CGCCTGCGCCGCGACCTTGAGGG + Intergenic
1100632307 12:96400626-96400648 GGCCGGGGGCGGGGCCTGCAGGG + Intergenic
1101150223 12:101877212-101877234 CGCCGGCGGCGGGACCTCGGAGG + Intergenic
1102068615 12:109999492-109999514 GGCCGGCTCAGGGACCAGGTCGG - Intronic
1102457143 12:113077862-113077884 CGCCGCCGCCGCCACCTGGAGGG + Exonic
1102962006 12:117099187-117099209 GGGCGGCGCGGGGACCGGGGCGG - Intronic
1104042239 12:125138200-125138222 GGCAGGCGCCGGGAGGAGGAGGG - Intronic
1104448831 12:128853518-128853540 CGCCGGCCCCGGGGCCTGGTCGG + Exonic
1105690868 13:22838198-22838220 GGCTGGCGCCTCGACCCGGAGGG + Intergenic
1105768065 13:23579879-23579901 GGCGGGCGCCGGGGCCGGGTCGG - Intronic
1108350349 13:49585656-49585678 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1112344370 13:98577325-98577347 GGCGGGCGGCGGGGCCGGGAGGG + Intronic
1113517697 13:110915496-110915518 GGCCGGGGGCGGGGCCTGGCTGG + Intergenic
1113541973 13:111115825-111115847 GGCCGGCGCCAGGACCGTGGCGG + Intronic
1113885499 13:113656588-113656610 GGCCGGCCCCAGGAGCTGGCGGG - Intronic
1114629055 14:24147645-24147667 TGCCCGCGCCGGGTCCTGGCGGG + Exonic
1116437572 14:44912212-44912234 GGCCGGCGCCGGTTCCGGGTGGG + Intergenic
1117315671 14:54568209-54568231 CAGCCGCGCCGGGACCTGGACGG + Intronic
1118148375 14:63164616-63164638 GGCCAGGGCCGGCACCTGGTAGG - Intergenic
1119286389 14:73458353-73458375 GGCCGGGGCCGGGGCCAGGGCGG - Intronic
1119666972 14:76491721-76491743 GGGCGGCGGCGGGGCCTGGAAGG + Intronic
1120759199 14:88270924-88270946 GGCAGGCGCCAGGTCCTGGAAGG - Intronic
1122234242 14:100323057-100323079 GGCCTGGGCTTGGACCTGGAGGG + Intergenic
1122408564 14:101514421-101514443 GGCTGGAGCCTGGACATGGAGGG - Intergenic
1122880736 14:104689515-104689537 GGCCGGGGGCGGGGCCTGGGGGG - Intergenic
1123500545 15:20877754-20877776 GGCCCGCGGCTGGACCTGCAAGG - Intergenic
1123557790 15:21451447-21451469 GGCCCGCGGCTGGACCTGCAAGG - Intergenic
1123594017 15:21888728-21888750 GGCCCGCGGCTGGACCTGCAAGG - Intergenic
1123709978 15:22980187-22980209 GGGCGGCGGCGGGGCCGGGACGG - Intronic
1123710074 15:22980450-22980472 GGCCGGGGCCGCGGCCGGGAGGG - Intronic
1125516582 15:40324244-40324266 GGTGGGCGCCGGGACCTCGGGGG + Intergenic
1126406972 15:48331778-48331800 GCCCGGCGCCGGGGCCGGGTAGG + Exonic
1128600279 15:68990086-68990108 GGCCTGTGCCAGGACCTGGAGGG - Intronic
1130531119 15:84748506-84748528 GCCTGGCGGCGGGACCTGGCTGG - Intergenic
1202966140 15_KI270727v1_random:178619-178641 GGCCCGCGGCTGGACCTGCAAGG - Intergenic
1132464743 16:72364-72386 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1132519624 16:381387-381409 GCCCGGCGCGGGGAAGTGGAGGG - Intronic
1132675424 16:1119359-1119381 GAGCCGCGCCGGGGCCTGGAGGG - Intergenic
1132779359 16:1614322-1614344 GGCCGGGGCCGGGGCCGGGCAGG + Intronic
1132832765 16:1937238-1937260 GGCCTGCCCCAGGCCCTGGAGGG - Intergenic
1133802101 16:9092310-9092332 GGCCGGGGCCGGGCCCGGGCGGG - Intronic
1136223896 16:28846092-28846114 GGCCGGCGGCGAGACCTGCCGGG + Exonic
1136505544 16:30700660-30700682 GGTGGGCCCCGGGCCCTGGAAGG + Exonic
1137559251 16:49492485-49492507 GGCCGGGGCCGGGGCCGAGACGG + Intronic
1137787447 16:51150755-51150777 GGCCGGCGCCGGGAGCGCTAGGG + Intronic
1141575367 16:84959950-84959972 GGCCATCGCCGGAAGCTGGAGGG + Intergenic
1141655871 16:85416300-85416322 GCCCGGGGCCGGGAGCTGGGAGG + Intergenic
1142664735 17:1456163-1456185 GGCGGGCGCCGGGGGCCGGAGGG - Exonic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1142811948 17:2399646-2399668 GGCCGGGGGCGGGGCCTGGGCGG - Intronic
1143581981 17:7833083-7833105 GTCCGGGGCCTGTACCTGGAAGG + Exonic
1143732432 17:8888677-8888699 GGCCGGCCCCGAGGCCTGGGAGG + Exonic
1144799222 17:17913434-17913456 GGCCAGGGCCGGCACCTGGTAGG + Intronic
1146022822 17:29293535-29293557 AGCCGGGGCCGGGGCCAGGAAGG + Intronic
1146162916 17:30569674-30569696 GGCCTGCGCAGGGTGCTGGATGG - Intergenic
1146176372 17:30668390-30668412 GGGGGGCGCTGGGGCCTGGAGGG + Intergenic
1146349832 17:32084504-32084526 GGGGGGCGCTGGGGCCTGGAGGG + Intergenic
1146455380 17:33005443-33005465 GGCCGGAGCTGGGACTTGGATGG + Intergenic
1147187431 17:38720292-38720314 GACCGGGGGCGGGGCCTGGAGGG - Intronic
1148081336 17:44968845-44968867 GGACGGAGCGGGGAGCTGGAAGG + Intergenic
1148780220 17:50117332-50117354 GGTGCGCGCCGGGACCGGGAGGG + Intronic
1149855417 17:60078661-60078683 GGCCGGGGCCGGGGCCAGCAGGG + Intronic
1151802007 17:76384381-76384403 AGGCGGCGCCGCGACCTGGCCGG - Intronic
1151812549 17:76453025-76453047 GGCGGGCGCCGGCGCCGGGACGG + Exonic
1151876459 17:76870135-76870157 GGGCTGGGCCGAGACCTGGAGGG - Intronic
1151938958 17:77281203-77281225 GGCGGGCGCCGGGCCTGGGAGGG - Intronic
1152077605 17:78168902-78168924 GGCGGGACCCGGGACCGGGAGGG - Intronic
1152107962 17:78341902-78341924 GGCCCGCGCGTGGACCGGGAGGG + Intergenic
1152645830 17:81468163-81468185 GGCCGGCACAGGTACCTGGGGGG + Intergenic
1152744566 17:82032843-82032865 GGCCAGCCCCGGGAGCTGGGGGG + Intronic
1153596426 18:6729793-6729815 GGCCGGCGCCGAGACATGCGCGG + Intronic
1153900479 18:9614134-9614156 GGCCTGGGCCGGGCCCTGGCTGG - Intronic
1155257440 18:24011208-24011230 GGTCTGCTCCAGGACCTGGATGG - Intronic
1160163212 18:76491271-76491293 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1160334562 18:78027148-78027170 AGGAGGCGACGGGACCTGGAGGG - Intergenic
1160559555 18:79747561-79747583 GGGCTCCGCGGGGACCTGGAAGG - Intronic
1160779118 19:870055-870077 GGCCAGCCCCGGGCCCTGCAAGG + Intronic
1160807076 19:996603-996625 GGACGGCGCCGGGACTGGGGAGG + Intronic
1160865086 19:1252805-1252827 GGCGGGGGCCGGGAGCTGGGTGG + Intronic
1160909861 19:1469450-1469472 GGCCGGGGCCGGGCCCTGCCGGG - Exonic
1160979995 19:1812352-1812374 GGCCGGGGGCGGGGCCTGGAGGG + Intergenic
1161047608 19:2144485-2144507 GGCCGGGGTCTGGTCCTGGATGG - Intronic
1161065644 19:2236090-2236112 GGCCGGGGCCGGGGTCTGGGCGG - Intronic
1161373077 19:3924426-3924448 GGCAGGAGCCGGGCCCTGAAGGG + Intronic
1161398696 19:4058387-4058409 GGGCAGCGCCGGGCCCTGGGGGG + Intronic
1161473408 19:4472482-4472504 GGCCGGAGGCGGGCACTGGAGGG + Intronic
1162481471 19:10929197-10929219 GGCCGGCGCCAGCAGCAGGAGGG - Exonic
1162753491 19:12843335-12843357 GGCAGGCACCGGGAATTGGAGGG - Intronic
1162935198 19:13978576-13978598 GGGCGGAGCTGGGACCTGGACGG + Intronic
1162982453 19:14248507-14248529 GGGGGGCGCTGGGGCCTGGAGGG - Intergenic
1163243182 19:16076653-16076675 GGCCTGCAGCGGGAGCTGGACGG + Intronic
1163329719 19:16628441-16628463 GCCCCGCCCCGTGACCTGGACGG - Intronic
1163426984 19:17245442-17245464 GGCCGGGCCCGGGGCCGGGAGGG + Exonic
1164592890 19:29515841-29515863 CACCGGCCCCGGGTCCTGGAAGG + Intergenic
1164648216 19:29874092-29874114 GGCTGGCTGCGGGTCCTGGAGGG + Intergenic
1165448567 19:35869659-35869681 GGCCGACCCCGGGGCCTGGATGG - Exonic
1166231365 19:41427298-41427320 GGCCGGCACCCGGAGCTGGCGGG - Exonic
1166304095 19:41928002-41928024 GGCCGGCGCAGGGGCGGGGAGGG - Intronic
1167307741 19:48719038-48719060 GGCCGGGATGGGGACCTGGACGG + Exonic
1167592085 19:50409553-50409575 CTCCGGCGCCAGGTCCTGGATGG + Exonic
1167622756 19:50568341-50568363 GGCCGGGGCCGGGGCCTGGGGGG - Intergenic
1168241463 19:55091214-55091236 GGCCAGAGACGGGACCAGGAAGG - Exonic
1168309021 19:55451552-55451574 GGGCGGCGCAGGGATCTGGGCGG - Intergenic
925085063 2:1101262-1101284 GGCCTGGGCCTGGGCCTGGAGGG - Intronic
925180535 2:1814314-1814336 GGCCAGAGCCTGGGCCTGGAGGG - Intronic
927215425 2:20665827-20665849 GGCAGGCGTCGGGACCTAGGCGG + Intergenic
929789740 2:45013932-45013954 GGGTGGCGCCGGGACCAGGCGGG + Intergenic
936797528 2:116224789-116224811 TGCCGGCCCCAGCACCTGGATGG + Intergenic
937361727 2:121234348-121234370 GGCAGGCTGCGGGACCTGGGAGG - Intronic
937911541 2:127078023-127078045 GGCTGGCTCCGGGTCTTGGAAGG - Intronic
944221890 2:197311013-197311035 GGCCGGCCCCGGGCCCTGGGCGG + Intronic
944263366 2:197697609-197697631 GGCCAGGGCCGGCACCTGGTAGG + Intronic
945305268 2:208254287-208254309 GGCGGGCGTGGAGACCTGGAAGG - Exonic
946254793 2:218434614-218434636 GGCCCGCGCTGGGACCTCAAAGG - Exonic
948393334 2:237627566-237627588 GGCCGGGGCCGGGGCCGGGCCGG + Intronic
948902671 2:240964275-240964297 GGCCGGCACCGGGACCTGGGTGG + Intronic
1169211303 20:3767586-3767608 GGACAGGGCCGGGACCGGGAGGG + Intronic
1172015437 20:31870272-31870294 GGCCGGGGCGGGGACCGGGGAGG + Intronic
1173454093 20:43189771-43189793 GGCCGGGGCCGGGACTGGGGCGG + Exonic
1173643372 20:44618628-44618650 AGCTGGCGCCGGGACTTGGGCGG + Exonic
1173687838 20:44936629-44936651 AGCCGGCTCCTGGACCTGCATGG - Exonic
1173909178 20:46651462-46651484 AGCCGGCGCCGGGGCCAGGCGGG - Intronic
1174357786 20:50009967-50009989 CGCCGGGGCCGCGGCCTGGAGGG - Intergenic
1174380676 20:50153613-50153635 GGCGGGCGCCGAGAACTGGCCGG - Exonic
1174486916 20:50866916-50866938 GGCCCGCGATGGGACCTGAAAGG - Intronic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175261828 20:57679550-57679572 GGCGGGTTCCGGGACCTGCAGGG + Intronic
1175408268 20:58749317-58749339 GGCAGGAGCTGGGTCCTGGAGGG + Intergenic
1175428806 20:58888992-58889014 GGCCGGTGCCGGGACCGCGCGGG - Intronic
1176005578 20:62860954-62860976 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1176051224 20:63120698-63120720 GGGAGGGGCCAGGACCTGGAGGG - Intergenic
1179504027 21:41828165-41828187 CACCAGCGCCGGCACCTGGAAGG - Exonic
1180866495 22:19122657-19122679 GGCCGGGGCCGGGGCCTGAGCGG + Intergenic
1181023935 22:20117143-20117165 GGCCGGCGCGGGCCCCTGGCGGG - Exonic
1181057754 22:20268021-20268043 GGCCGGCGGCGGGGCGCGGAGGG - Intronic
1181917170 22:26290720-26290742 GGCAGGGGCCAGGCCCTGGAGGG - Intronic
1182475540 22:30574642-30574664 GGCTGGCGGCGGCACCTGGCCGG - Intergenic
1184409605 22:44318928-44318950 GGCCAGCGCCGCATCCTGGAGGG - Intergenic
1185278760 22:49961052-49961074 GGCCGGGGCCGGGGCCAGGGCGG + Intronic
950400958 3:12768909-12768931 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
954599550 3:51857727-51857749 GGCCAGGGCCGGCACCTGGTAGG - Intergenic
958638595 3:96777084-96777106 GGCGGGCGCAGGGACCTGGCTGG + Intergenic
961827613 3:129606951-129606973 GGCCGCGGGCGGGTCCTGGAGGG - Intergenic
962222358 3:133574197-133574219 GGCGGGCGCGGGGACCCGGCCGG + Exonic
964484606 3:157174802-157174824 CGCCGGCGGCCGGACCTGCAGGG - Intergenic
967938755 3:194749965-194749987 GGCCTGCGCAGGGTCCTGCAGGG - Intergenic
968506438 4:973342-973364 GGCCGGGGCCGGGACCCGAGCGG - Exonic
968655285 4:1775903-1775925 GGCAGGCGCCGGGGGCTGGCAGG + Intergenic
968741635 4:2334407-2334429 GGCCAGCGGCGGGGCCTGCAGGG - Intronic
968803102 4:2755945-2755967 GGCGGCCGCCGGGTCCTGGGTGG - Intronic
969285510 4:6199949-6199971 GGCTGGGGGCGGGACCGGGAGGG + Intronic
971294482 4:25376919-25376941 GCTGGGCGCCGGGACCTGAAAGG - Intergenic
985551231 5:534582-534604 GGCCTGAGACGGCACCTGGAGGG + Intergenic
985590079 5:759970-759992 GGCCGGCGCTGGGCTCAGGACGG - Intronic
985748883 5:1663345-1663367 GGGCGGGGCTGAGACCTGGAGGG + Intergenic
985996034 5:3597334-3597356 GGCGGGCGCGGGGCCCTGGGAGG + Intronic
986588845 5:9347673-9347695 GGCAGGAGCAGGGACCTGCATGG + Intronic
987303482 5:16617185-16617207 GCCGGGCGCCGGGAGCTGGGCGG + Intergenic
990189517 5:53243349-53243371 GGCTGGAACAGGGACCTGGAAGG + Intergenic
996291004 5:121852134-121852156 GGCCGGCGGCGGGCCCGGTAGGG - Exonic
997521725 5:134527560-134527582 GGGCGGCGCCGGGAGGTGGGTGG - Intronic
999673010 5:153974010-153974032 GGCTGGAGCTGGGACCAGGAGGG + Intergenic
1000052590 5:157575607-157575629 GGGCGGCGCGGGAGCCTGGATGG - Exonic
1001740681 5:174050700-174050722 GGCAGGCTCCTGGACCTGGAAGG + Intronic
1002291568 5:178204295-178204317 GGACGGCGCCGGGTCCAGGGCGG - Intergenic
1002498433 5:179631959-179631981 GGCCGCCTCCGGGACCTGCTCGG + Intronic
1006170217 6:32087925-32087947 GGCCGGGGCCGGGACTTGGGGGG + Intronic
1006535617 6:34696660-34696682 GCCGGGCCCGGGGACCTGGAGGG + Exonic
1006665231 6:35688717-35688739 CGACCGCGGCGGGACCTGGAAGG + Intronic
1006826380 6:36939073-36939095 GGCCAGGGCCGGCACCTGGTAGG + Intergenic
1007614521 6:43172188-43172210 GGCCGGCCCCGGGGCCCGGTTGG + Intronic
1010209884 6:73354329-73354351 GGCCGGGGGCGGGGCCTGGCCGG - Intergenic
1010246204 6:73661896-73661918 GGCCAGGGCCGGCACCTGGTAGG + Intergenic
1011633891 6:89352800-89352822 GGCCGGCGCCGGTGCCTGCCAGG - Exonic
1017671835 6:156777203-156777225 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1019159915 6:170062880-170062902 GGCCGGAGCTGGGAGCTGGGAGG - Intergenic
1019408955 7:898375-898397 GGCAGGGGCCGGGACCTGTGTGG + Exonic
1019415168 7:923726-923748 GTCCGGAGCAGGGTCCTGGAAGG - Intronic
1019428216 7:987224-987246 GGCCGGCACCCGGACGTGCAGGG + Exonic
1019738863 7:2663122-2663144 GGCCAGGGCCGGGACCGGGAGGG - Exonic
1023017733 7:35983780-35983802 AGCAGGCGCCTGGGCCTGGAGGG + Intergenic
1026858707 7:73770898-73770920 GGCCAGCGATGGGAACTGGAGGG - Intergenic
1026940701 7:74286387-74286409 GGCAGGCGGGGGGATCTGGAGGG - Intergenic
1028113128 7:86966815-86966837 GGCAGCCGCCAGAACCTGGAAGG - Intronic
1029145371 7:98442039-98442061 AGCCGGAGCCCGGGCCTGGAAGG - Intergenic
1029440501 7:100584426-100584448 GGCCGGGGGCGGGAGCTGGGAGG + Intronic
1029483829 7:100827529-100827551 GGGCGGCGCCGGGCCCGGGAGGG + Intronic
1029926936 7:104328530-104328552 GGCCGGAGCCCGGGCCAGGAGGG + Intergenic
1031317270 7:120273362-120273384 GGCCGGGGCCGGGGCCGGCACGG - Intergenic
1033732805 7:144195574-144195596 GGCCGGCGCCGGGACCTGGAGGG - Exonic
1033743656 7:144294154-144294176 GGCCGGCGCCGGGACCTGGAGGG - Intergenic
1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG + Exonic
1035351151 7:158247272-158247294 GGCAGGCGCCAGGATCTGGAAGG + Intronic
1035677696 8:1467065-1467087 GCCCGGCCCCGGGACCAGGATGG + Intergenic
1042465883 8:69129675-69129697 GGCCTGCAGCGGGAGCTGGACGG + Intergenic
1044242511 8:89902904-89902926 GGCCCGGGCCGGGACCGGGGTGG + Intronic
1049166375 8:141128559-141128581 GGCTGGAGGCGGGGCCTGGAGGG - Intronic
1049343002 8:142123732-142123754 GTCCAGCGCCGGGGCCTGGATGG + Intergenic
1049726093 8:144147248-144147270 GGGCGGCACCGAGACCGGGAGGG + Intergenic
1049732418 8:144185570-144185592 GGGCGGCGCAGGGGCCTTGAGGG + Intronic
1049732452 8:144185654-144185676 GGGCGGCGCAGGGACCTCGAGGG + Intronic
1049732489 8:144185738-144185760 GGGCGGCGCGGGGACCTCGAGGG + Intronic
1049732515 8:144185801-144185823 GGGCGGCGCAGGGACCTCGAGGG + Intronic
1051726090 9:20089257-20089279 GACCGGGACCGGGACCTGTATGG - Intergenic
1052362244 9:27573516-27573538 GGCCGGGGCCGGGGCGTGGTCGG - Intronic
1053306198 9:36986298-36986320 CGCCAGCGCTGGGACCTGCAGGG + Intronic
1058686996 9:107488527-107488549 GGACGTCCACGGGACCTGGAGGG - Intronic
1060485743 9:124045369-124045391 GGCCAGAGCCGGGCCCCGGAGGG + Intergenic
1060855985 9:126915167-126915189 GCCCGGCGCCGGGGCCTGGCCGG + Intronic
1061378777 9:130241828-130241850 GGCCCGAGCTGGGACCTGCAGGG + Intergenic
1061556528 9:131373403-131373425 TGCCGGCGCCGGGACCCTGCGGG + Intergenic
1061878036 9:133554644-133554666 GGCCGGCGGCGGGGCCTGCGAGG + Exonic
1061991739 9:134163166-134163188 CGCAGGCCCCGGGAGCTGGAGGG - Intergenic
1062567515 9:137169912-137169934 GGCCGAGGCCGCGACCAGGAAGG + Exonic
1196080001 X:111620759-111620781 GGCCCACGCCGGGATATGGATGG - Intergenic
1196274839 X:113754974-113754996 GGCCAGCCCAGGGACCAGGAGGG + Intergenic
1200160575 X:154006132-154006154 GGCCGGAACTGGGATCTGGAAGG + Intergenic
1200209658 X:154341606-154341628 GGCCGGGGCCGGGGCCGGGGCGG + Intergenic
1200221194 X:154390486-154390508 GGCCGGGGCCGGGGCCGGGGCGG - Intronic