ID: 1033751274

View in Genome Browser
Species Human (GRCh38)
Location 7:144363501-144363523
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 0, 2: 1, 3: 21, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900241546 1:1619766-1619788 CAGGCACAAGAAGTGAGGCCAGG + Intronic
901514439 1:9735526-9735548 CAGGTACGAGATGTGCTGCATGG + Exonic
906040861 1:42786774-42786796 CAGGGGCAAGATGTGGTGCCTGG - Intronic
908247950 1:62242860-62242882 CAGGTACAAGCCTTGGTGCTTGG + Intronic
910719234 1:90267313-90267335 AAGGAACAAGAGGTGATGGTGGG + Intergenic
911089622 1:94008179-94008201 CAGGCACAAGAGCTGATGTTCGG + Intronic
911235818 1:95411082-95411104 CAGGCCCAGGATGTGATGCTGGG + Intergenic
912023526 1:105138173-105138195 CAGGCACAAGATGTGCACCTGGG - Intergenic
912843492 1:113059632-113059654 CAGGGACAAGATGGTTTGCTGGG + Intergenic
915450664 1:156002834-156002856 CAGGTACAAGAAGCCATGCTGGG + Intronic
917818969 1:178741535-178741557 TAGAAACAAGATGTGATTCTTGG + Intronic
921034764 1:211366408-211366430 CAGGTACAATGTTTGCTGCTAGG + Intronic
924533311 1:244912118-244912140 CAGATACAAGAAGTGATATTGGG + Intergenic
1063146519 10:3299625-3299647 CAGGTGCACGATGAGATGCATGG + Intergenic
1065426947 10:25615842-25615864 GAGGCACAAGATGTGTTGCCTGG + Intergenic
1068501457 10:57843771-57843793 CAGCTAGGAGATGTGATTCTGGG + Intergenic
1071079314 10:81791308-81791330 CAGGTACAATATATGTTGCTGGG + Intergenic
1071929641 10:90453906-90453928 AAGGGACAAGCTGTGATGATGGG - Intergenic
1074933855 10:118158256-118158278 AAGGTACAAGAAGGGATGGTAGG + Intergenic
1075580995 10:123618363-123618385 CTGGACCAAGAAGTGATGCTGGG + Intergenic
1077907447 11:6545393-6545415 CAGGTACAACTTGTTTTGCTTGG - Exonic
1078164916 11:8874296-8874318 TAGCTACAAGATGTGTTGCCAGG - Intronic
1078274768 11:9833242-9833264 AAGTTACAGGATATGATGCTGGG + Intronic
1080279585 11:30541156-30541178 CAAGAACAAGATTTGAGGCTTGG - Intronic
1081075776 11:38672009-38672031 CAGGGACAAGACGAGATTCTGGG + Intergenic
1083738642 11:64695884-64695906 CAGGAACAAGAAGGGAAGCTGGG - Intronic
1086204228 11:84238589-84238611 CAGGAACTTTATGTGATGCTTGG - Intronic
1086943140 11:92818588-92818610 CAGTTACTAGATGTGTTTCTTGG - Intronic
1087232524 11:95682316-95682338 CATGTCCAAGTGGTGATGCTAGG + Intergenic
1088031284 11:105253929-105253951 CAGGTACAAGATGTCATGCAGGG - Intergenic
1088692881 11:112342834-112342856 CAGGCACAAGATGCCATGCCTGG + Intergenic
1089681015 11:120118968-120118990 CAGGCACCAGGTGTGATGCAGGG - Intronic
1090563780 11:127964169-127964191 AATGTACAAGATGTGTTGCCTGG - Intergenic
1091190850 11:133694259-133694281 CAGGTGCAAGGGGTGATACTGGG - Intergenic
1091728896 12:2865261-2865283 CAGAGACAAGATGTGATGTGGGG - Intronic
1092504491 12:9082314-9082336 CAGTCACAAGATGTGTTGCCTGG - Intronic
1092571378 12:9726457-9726479 CAGGGACAAAATGTGAAGTTAGG + Intronic
1092735922 12:11582751-11582773 CAGACACAAGGTGAGATGCTAGG - Intergenic
1093855569 12:24098106-24098128 TAGGTAGTAGGTGTGATGCTTGG + Intergenic
1094063002 12:26334554-26334576 CAGTTACCAAATGTGATGCTGGG - Intergenic
1094373547 12:29765097-29765119 CATATAGAATATGTGATGCTGGG - Intronic
1095674929 12:44905400-44905422 CAGCTACAAGAACTTATGCTTGG - Intronic
1096896673 12:54827864-54827886 CATGTGCCAGTTGTGATGCTAGG - Intergenic
1100647911 12:96550865-96550887 CAGGGACAAGAGATGAGGCTTGG + Intronic
1100764692 12:97850781-97850803 CATCTACAAGATGTCATGTTTGG - Intergenic
1101547791 12:105732951-105732973 CAGGGACAAGGTGTGAGGCACGG - Intergenic
1104104328 12:125644790-125644812 CAGGTACAAGTTGTAAAGCTGGG - Intronic
1106082844 13:26514868-26514890 AAGGTACCTGATCTGATGCTAGG - Intergenic
1109423327 13:62142190-62142212 GAGTTGCAAGATCTGATGCTTGG + Intergenic
1112599606 13:100841881-100841903 CAGGTACAATCTATGATGCTGGG - Intergenic
1114498483 14:23150937-23150959 CAGGTACAGGCTGTGGGGCTGGG + Intronic
1117110010 14:52442817-52442839 AAAGTTCAAGATGTTATGCTGGG + Intronic
1121429256 14:93875228-93875250 CAGGCATAAGCTGTCATGCTTGG - Intergenic
1125194067 15:37026542-37026564 CAGCAACAAGATTTGATGCTGGG + Intronic
1125361023 15:38865048-38865070 CAAGTACAACATGTCATGCAAGG + Intergenic
1126429163 15:48562233-48562255 CAGGTCCGTGCTGTGATGCTGGG + Intronic
1126818739 15:52480071-52480093 AAGGTATACGATGTGATGCTAGG - Intronic
1128729412 15:70010728-70010750 AAGGGACCAGATGTGATGCAGGG - Intergenic
1129896861 15:79114845-79114867 CATGTACAAGATCTCCTGCTAGG - Intergenic
1135789931 16:25384561-25384583 CAGGGACAAGCTGTGATTCAAGG + Intergenic
1138071357 16:53996031-53996053 CAGTGACAAGACATGATGCTGGG + Intronic
1140146688 16:72318159-72318181 CAGGTATAAGAAGAGATGCCTGG - Intergenic
1140558004 16:75943731-75943753 CAGGTAGAATATGAGATGCAGGG + Intergenic
1142760773 17:2040852-2040874 CAGGTACTAAATGTGGTTCTGGG + Intronic
1142863734 17:2778142-2778164 CAGCTCCAAGCTGTGGTGCTGGG + Intronic
1147204993 17:38830864-38830886 CAGACACAAGATGTGAAGCTGGG + Intergenic
1148160020 17:45444412-45444434 CAGGAATGGGATGTGATGCTGGG - Intronic
1149654536 17:58303239-58303261 CAGGTACCAGAGGTGAAGGTGGG - Intronic
1149980086 17:61303844-61303866 CAGGCACAAGACTTGGTGCTGGG - Intronic
1150391311 17:64791291-64791313 CAGGAATGGGATGTGATGCTGGG - Intergenic
1150410094 17:64935335-64935357 CAGGAATGGGATGTGATGCTGGG - Intergenic
1150472496 17:65449017-65449039 CAGCTATAAGATATCATGCTTGG - Intergenic
1151466372 17:74288306-74288328 CTGGACTAAGATGTGATGCTGGG + Intronic
1152047975 17:77950906-77950928 CAGGTATTAGATGTGAGGGTGGG - Intergenic
1152160538 17:78665822-78665844 CTGGTGCAGGATGAGATGCTGGG - Intergenic
1154065692 18:11104911-11104933 CAGGTACAATGTTTGGTGCTGGG + Intronic
1157563937 18:48667291-48667313 CAGGTATAAAGTGTGATGCCTGG + Intronic
1157961074 18:52153997-52154019 CAGAAACAAGATGTGATCCCAGG + Intergenic
1159564317 18:70031870-70031892 CAGGAACAAGTTGTGGTGCTTGG - Intronic
1160247027 18:77166998-77167020 CAGGCACTAGATGAGATGCCAGG + Intergenic
1164402645 19:27912225-27912247 CAGGTACAGGATGAGTTGCTAGG - Intergenic
1165318782 19:35073721-35073743 CAGGGCCAAGATGTGTGGCTGGG - Intergenic
1166090040 19:40502931-40502953 CAGGTACAAGGTGTAGGGCTTGG + Exonic
1166588979 19:43978660-43978682 CAGGTACTACATATGAAGCTAGG - Intronic
1167849677 19:52191743-52191765 CATGTATGAGATATGATGCTGGG + Intronic
925708349 2:6712817-6712839 CAGGAATAAGATGTGATGATTGG + Intergenic
926906414 2:17809815-17809837 TAGGTACAAGATGCAAGGCTTGG - Intergenic
928438532 2:31272203-31272225 CAGGTTCAGGATGTGATTTTAGG + Intergenic
935226292 2:101055805-101055827 CAGGTAGCACATGTGAGGCTTGG - Intronic
940693316 2:156947117-156947139 CAGGGTCAAGATCTGATTCTAGG - Intergenic
943453669 2:188075900-188075922 CAGGAACAAGTCCTGATGCTTGG + Intergenic
945448355 2:209965056-209965078 TGGGTAAATGATGTGATGCTTGG + Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
948533282 2:238627439-238627461 CAGGGACCAGATGTGATGGTTGG + Intergenic
1169669669 20:8082405-8082427 CAGCTACAAAATGTTCTGCTGGG - Intergenic
1169863404 20:10174470-10174492 CAGGCAGAAGATGTGATACAAGG + Intergenic
1169873636 20:10273076-10273098 CAGGTCCTAGATCTGATCCTGGG - Intronic
1173101145 20:40090079-40090101 GAGGTAGAAGAGGTGATGATGGG + Intergenic
1173182910 20:40818093-40818115 CAGGCACAAGATCCCATGCTAGG + Intergenic
1173871348 20:46344002-46344024 CAGGAACAGGATGGGAGGCTTGG + Intergenic
1178389095 21:32184128-32184150 CAGGTGGCAGTTGTGATGCTGGG - Intergenic
1178399765 21:32275496-32275518 CAAGTAAAAGATGTGTGGCTGGG - Intronic
1178859772 21:36279077-36279099 CAGATGCAAGATGTGCTCCTGGG + Intronic
1182583550 22:31329435-31329457 CAGGTAGAAGACGGGATCCTTGG - Intronic
949341419 3:3034788-3034810 CAGGTACCATATTGGATGCTTGG + Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950533591 3:13567091-13567113 CATGGACAGAATGTGATGCTGGG + Intronic
951212455 3:19990443-19990465 CAGGTAAACAATGTGCTGCTGGG - Intronic
952897610 3:38088594-38088616 CAGGTTTGTGATGTGATGCTAGG - Intronic
958185231 3:90111217-90111239 CAGGTACAAGAGATGAGGCCAGG + Intergenic
958997269 3:100918870-100918892 CAGGTAAAGGATTTGAAGCTAGG - Intronic
959762095 3:109977745-109977767 CAGGTACCAGATATGGTGGTTGG - Intergenic
961832401 3:129630436-129630458 CAGGTGCAAGCTGCCATGCTTGG + Intergenic
962003296 3:131322983-131323005 CAGACATAAGATGTGATGCAGGG - Intronic
964071982 3:152646304-152646326 AAGGAGCAAGGTGTGATGCTGGG + Intergenic
964379329 3:156082086-156082108 CAGGGTAAAGATGTGTTGCTAGG - Intronic
971354614 4:25884091-25884113 CAGGGACAAGGGGTGAGGCTGGG - Intronic
972181670 4:36474522-36474544 CATGTACAAGATGCCATACTAGG + Intergenic
974942923 4:68490123-68490145 CAGGAACAAGTTCTGGTGCTTGG + Intronic
980431150 4:132698101-132698123 CAGGAACAAGATGAGATGAGAGG + Intergenic
981952598 4:150427904-150427926 ATGGTAGAAGATGTGCTGCTAGG + Intronic
982013903 4:151133215-151133237 GAGGCTCAAGATGTGTTGCTCGG - Exonic
982167359 4:152626422-152626444 AAGGTACAAGAATTGAGGCTTGG + Exonic
982719410 4:158844221-158844243 CAGGTACTATATGAGCTGCTGGG - Intronic
983898406 4:173105883-173105905 CAGGCCCAAGATGTGGTGCTGGG - Intergenic
983924736 4:173387956-173387978 CAGGTATAAGCTGAGATTCTTGG - Exonic
986939641 5:12935441-12935463 CAGGTGCAAGCTGTGCTCCTGGG + Intergenic
987357127 5:17073731-17073753 CAGGCACAAGCTGCCATGCTTGG - Intronic
987861495 5:23492847-23492869 CAGGAACAAGTCCTGATGCTTGG + Intergenic
991941570 5:71858071-71858093 CAGGTTCAAGAGATGATGCTGGG - Intergenic
992593511 5:78321520-78321542 CAGTTAGTAGATGTGCTGCTGGG - Intergenic
993147493 5:84113858-84113880 CTCGTATAAGATGAGATGCTCGG - Intronic
993187640 5:84640581-84640603 CTGGACAAAGATGTGATGCTAGG + Intergenic
993734245 5:91457301-91457323 CAGAAACAAGATGTCATACTAGG + Intergenic
995359850 5:111283003-111283025 GTGGTACAACCTGTGATGCTGGG - Intronic
995616929 5:113975033-113975055 CAGGTACAATATGTGCTACCTGG + Intergenic
997348078 5:133208262-133208284 CAGGTAAATGATGTCTTGCTTGG + Intronic
998318633 5:141208381-141208403 CAGATACAAGATGTGATCCCTGG - Intergenic
1001317616 5:170655549-170655571 CAGGTCCTAGATGTGTTGCTAGG + Intronic
1001703625 5:173725176-173725198 CAGGAAAAGGAAGTGATGCTGGG + Intergenic
1004411570 6:15385999-15386021 TAGGTACAAGGTATGTTGCTTGG + Intronic
1006713268 6:36094695-36094717 CATGTACCAGATGTTAGGCTGGG + Intronic
1010007917 6:71015591-71015613 GAGGTCCATGATGTAATGCTGGG + Intergenic
1010906472 6:81496669-81496691 AAGGAACAATATGTTATGCTAGG - Intronic
1012889290 6:104880357-104880379 CAGTTAGTAGATGTGATGTTGGG + Intergenic
1015598161 6:134886278-134886300 CAGGTACAAGATCTAGTGCTAGG - Intergenic
1016345965 6:143114244-143114266 CAGGTGAAATATGTAATGCTTGG + Intronic
1019891434 7:3950355-3950377 CAGATAGAAGATGGGATGATCGG - Intronic
1022685000 7:32589005-32589027 CAGGTGCAAAATGGGTTGCTTGG - Intergenic
1031922311 7:127611321-127611343 CAGGTAAAGGATGTGAGACTGGG - Intronic
1033731780 7:144187530-144187552 CAGGTACAAGATGTGATGCTTGG - Exonic
1033742629 7:144286113-144286135 CAGGTACAAGATGTGATGCTTGG - Intergenic
1033751274 7:144363501-144363523 CAGGTACAAGATGTGATGCTTGG + Exonic
1034427783 7:151023705-151023727 CAGGTTCTGGATGTGATGCCAGG + Exonic
1036171879 8:6494771-6494793 CAGGTACAGGATGTTTTTCTGGG + Intronic
1039908719 8:41807503-41807525 CAGATACAAGGTGTGATGTTGGG - Intronic
1040705036 8:50115421-50115443 CAGGCACCAGACATGATGCTCGG - Intronic
1041237925 8:55823528-55823550 CAGGTAGAAGAAGTGATCCAAGG + Intronic
1041764418 8:61403427-61403449 TAGGTACAAGAGGAGATGCAGGG + Intronic
1041982539 8:63879492-63879514 CACGTATAAGATGTTATACTAGG + Intergenic
1043263665 8:78233922-78233944 CAAGTATAAGATATGATGATTGG - Intergenic
1044674030 8:94711790-94711812 CAGGAACAAAATTTGATGCATGG - Intergenic
1047309749 8:123682256-123682278 CAGGTGCTAGAAGTGATGATAGG + Intronic
1048603957 8:135948043-135948065 CAGGTACAAAATATGACTCTTGG + Intergenic
1051118916 9:13730320-13730342 CTGCTACAAAAGGTGATGCTTGG + Intergenic
1051694065 9:19749747-19749769 CAGATAAAATATGAGATGCTAGG - Intronic
1055267858 9:74518769-74518791 CAGATATAAGATGTGCCGCTGGG + Intronic
1056025407 9:82489693-82489715 CAGATACATGATGTTATGCCAGG + Intergenic
1056692693 9:88821944-88821966 CAGGAACAAAATGTGCTGCTTGG + Intergenic
1057187187 9:93063426-93063448 CAGGTCCAAGACCTGCTGCTGGG + Intronic
1058639563 9:107069617-107069639 CAGGCACGAGCTGTCATGCTGGG + Intergenic
1061609369 9:131736303-131736325 CAGGAACAAGCTGGGATGCAGGG - Intronic
1062027416 9:134346959-134346981 CAGGTCCAGGATGTGGTGCCTGG - Intronic
1185910415 X:3975829-3975851 CAGGCCCAGGATGTGGTGCTGGG - Intergenic
1186649665 X:11545153-11545175 ATGGTACAAGAAGTGATTCTTGG + Intronic
1186792032 X:13008908-13008930 CAGGTGGAAGATGTGAGGATGGG + Intergenic
1188080522 X:25833929-25833951 CTATTACAAGAGGTGATGCTAGG - Intergenic
1189370568 X:40425331-40425353 CTGGTACAGGATGTTATGGTGGG - Intergenic
1192226587 X:69232436-69232458 CAGGTAAGAGTTGGGATGCTAGG - Intergenic
1193467687 X:81868384-81868406 CAGGAAGCAGATGTGATCCTGGG - Intergenic
1198013325 X:132582644-132582666 GAGGAAAATGATGTGATGCTTGG - Intergenic
1198711077 X:139505046-139505068 CAGGCACAAGAAGTGATGGAGGG - Intergenic