ID: 1033751558

View in Genome Browser
Species Human (GRCh38)
Location 7:144364901-144364923
Sequence TGGGAACCACTACACGAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 2, 1: 0, 2: 2, 3: 6, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033751558_1033751567 23 Left 1033751558 7:144364901-144364923 CCATGCTCGTGTAGTGGTTCCCA 0: 2
1: 0
2: 2
3: 6
4: 70
Right 1033751567 7:144364947-144364969 CCTCCATTGGCCCTAGGTTCAGG 0: 2
1: 0
2: 1
3: 9
4: 89
1033751558_1033751563 17 Left 1033751558 7:144364901-144364923 CCATGCTCGTGTAGTGGTTCCCA 0: 2
1: 0
2: 2
3: 6
4: 70
Right 1033751563 7:144364941-144364963 CACCCTCCTCCATTGGCCCTAGG 0: 2
1: 0
2: 2
3: 24
4: 223
1033751558_1033751568 24 Left 1033751558 7:144364901-144364923 CCATGCTCGTGTAGTGGTTCCCA 0: 2
1: 0
2: 2
3: 6
4: 70
Right 1033751568 7:144364948-144364970 CTCCATTGGCCCTAGGTTCAGGG 0: 2
1: 0
2: 0
3: 7
4: 104
1033751558_1033751561 10 Left 1033751558 7:144364901-144364923 CCATGCTCGTGTAGTGGTTCCCA 0: 2
1: 0
2: 2
3: 6
4: 70
Right 1033751561 7:144364934-144364956 GCATAGCCACCCTCCTCCATTGG 0: 2
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033751558 Original CRISPR TGGGAACCACTACACGAGCA TGG (reversed) Exonic
904261241 1:29288959-29288981 TGGGATCCACTAAAGGAGCCAGG - Intronic
910274731 1:85436883-85436905 TGGGAGACACTACTCAAGCAAGG + Intronic
916895565 1:169158650-169158672 TGGGAACCGCTGCACTAGGACGG + Intronic
922743609 1:228030759-228030781 TGGGAATTACTACAGGAGAAAGG - Intronic
1064006259 10:11701728-11701750 TGGGAACCATTACACCATCCTGG + Intergenic
1064413272 10:15126651-15126673 TGCCAACAACTACAGGAGCATGG + Intronic
1069228724 10:65978442-65978464 TGAGAACAACAACACGTGCAAGG - Intronic
1069593534 10:69656272-69656294 TGGCAACCACTCCCGGAGCAGGG - Intergenic
1076572612 10:131442489-131442511 CGGGCACCACAACACCAGCAGGG - Intergenic
1087930508 11:103972373-103972395 TGAGAACCACTGCTAGAGCAAGG + Intronic
1088002356 11:104897514-104897536 TGGGAACCACTACCCTAGAATGG - Intergenic
1088618049 11:111653099-111653121 TGAGAACCACTGCACTACCAGGG + Intronic
1088849556 11:113693840-113693862 TGGGAAGCTCTGCAGGAGCAGGG - Intronic
1089500540 11:118929199-118929221 TGGGAGCCAATAGAGGAGCAGGG + Intronic
1104209252 12:126671354-126671376 TGGGAAGCTCCACATGAGCAGGG - Intergenic
1107885694 13:44872638-44872660 TGGTGACCAGTACATGAGCATGG + Intergenic
1122411397 14:101527836-101527858 TGGGAACCGCTCCAAGAACACGG - Intergenic
1123062507 14:105600628-105600650 TGTGAACCACTCCACCAGAAAGG - Intergenic
1123087248 14:105722356-105722378 TGTGAACCACTCCACCAGAAAGG - Intergenic
1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG + Intergenic
1132110621 15:99099790-99099812 TGGGAGCCACTCCACCAGCATGG - Intronic
1133127188 16:3654598-3654620 TGGGGGCCACCACACGTGCAAGG + Intronic
1134891323 16:17844070-17844092 TGAGAACCACTGAACTAGCATGG + Intergenic
1136694554 16:32066151-32066173 CAGTAACCACTACACGAGCTGGG + Intergenic
1138213880 16:55186149-55186171 TGGGAACCCCTAAGAGAGCAAGG - Intergenic
1138224443 16:55280826-55280848 TGGGAACCGCTCCAGCAGCAGGG - Intergenic
1138904427 16:61313793-61313815 TGGGAACAACTACAGGATTAGGG + Intergenic
1139649677 16:68356035-68356057 TGGGAACCACCACACGCGCAGGG - Intronic
1203097312 16_KI270728v1_random:1271070-1271092 CAGTAACCACTACACGAGCTGGG + Intergenic
1149818639 17:59751959-59751981 TGTGCACCACTACACCAGCTGGG + Intronic
1156034630 18:32752746-32752768 TGGGAACCACTACAATAGCCTGG - Intronic
1158556421 18:58478441-58478463 TGGGAACCACTTCAGCAGAAAGG + Intergenic
925478744 2:4247423-4247445 TGGGTCCCACTGCACGGGCAGGG - Intergenic
937872909 2:126798687-126798709 TGGGGACCCCTGCAGGAGCAGGG - Intergenic
940083539 2:149832216-149832238 TGGGAACCAGTACTGGGGCAGGG - Intergenic
947094012 2:226545463-226545485 TGAAAACCACTAAACTAGCAGGG + Intergenic
947842104 2:233214413-233214435 CAGGAAACACTACAGGAGCAAGG + Intronic
948679394 2:239622543-239622565 TGGGAACTACTAGAGGGGCAAGG - Intergenic
1173819452 20:46011129-46011151 TTGGAACCACTGCAGGAGGAGGG - Exonic
1174417352 20:50376409-50376431 TGGCAACCACCTCACAAGCAGGG - Intergenic
1178749562 21:35287475-35287497 TGCCAACAACTACACGAGCTTGG + Intronic
1183428253 22:37751043-37751065 TGGCACCCACTAGATGAGCATGG + Intronic
951463529 3:22977130-22977152 AGGGAACCACTGCAGGTGCAAGG + Intergenic
958964424 3:100542872-100542894 TGGGGACCACTAGAGGAGGAAGG + Intronic
961142513 3:124567222-124567244 TGAGAACCACTGCACTAGCCCGG + Intronic
962501749 3:136001531-136001553 TGTGAACCACTACAGCAGCGTGG + Exonic
964211182 3:154229762-154229784 TGACAACCACTATACTAGCATGG + Intronic
967848427 3:194063161-194063183 TGGAAACCTCTAGAGGAGCAGGG - Intergenic
968627812 4:1635641-1635663 TGGGATCTACTCCACAAGCACGG + Intronic
970481854 4:16484170-16484192 TGGGAATCACTACTCTATCAGGG + Intergenic
973769130 4:54190650-54190672 TGGGAATCAATACAAGAGGAAGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
979705091 4:123711395-123711417 TGGGCACCAAAAAACGAGCAGGG + Intergenic
983655240 4:170076397-170076419 TACTAACCACTACACGATCATGG + Intronic
998046618 5:138992110-138992132 TGGCAATCACTACACGACTATGG + Intronic
1001139386 5:169131453-169131475 TGAGAACCACTAAATTAGCAGGG + Intronic
1003981328 6:11393111-11393133 TGGGAATCTCTACACGATAAGGG - Intergenic
1004164977 6:13249102-13249124 TGGGCACCCCTACACGAGCATGG - Intronic
1004881254 6:20010741-20010763 GGGGAACCTCTAGAAGAGCAGGG - Intergenic
1005824866 6:29626781-29626803 TGGGAACCCCCACAATAGCATGG - Intronic
1005836129 6:29710902-29710924 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005856901 6:29869658-29869680 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005862719 6:29913792-29913814 TGGGAACCATTACTAGAGAAGGG - Intergenic
1012511613 6:100009146-100009168 TGGGACCCACCACCCCAGCACGG - Intergenic
1021416157 7:20387541-20387563 TGAGAACCACACCACCAGCAGGG - Intronic
1026563232 7:71467932-71467954 TGAGAACCTCTACACCAGCCAGG + Intronic
1027466514 7:78522149-78522171 TGGGAACCACTAGACTGGCACGG - Intronic
1029807080 7:103009410-103009432 GGGGAACCACTACATGAGAAAGG + Intronic
1030114047 7:106049902-106049924 AGGCCACCACTACACCAGCAGGG - Intergenic
1031943836 7:127817833-127817855 TGGGAACTACTACAACAGAAAGG - Intronic
1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG + Intergenic
1033751558 7:144364901-144364923 TGGGAACCACTACACGAGCATGG - Exonic
1035040583 7:155923988-155924010 TGGGATCCACCAGACGAGCATGG - Intergenic
1036042135 8:5097084-5097106 TGGGAATCACTACAAGGGAATGG - Intergenic
1048982068 8:139707854-139707876 TGGGAACCCCTGGATGAGCATGG - Intergenic
1187155023 X:16713913-16713935 TGGACACCACTACACGATGATGG - Intergenic
1193747940 X:85305838-85305860 TGGCAACCACTACACGGAGATGG - Exonic
1195146067 X:102018487-102018509 TGGGAAGCACAACAAGAGCTTGG - Intergenic
1198213507 X:134536124-134536146 AGGGAAACACCACAAGAGCAGGG + Intergenic
1199734201 X:150668844-150668866 TGGAAACCACTACATGTGGAAGG + Intronic