ID: 1033756929

View in Genome Browser
Species Human (GRCh38)
Location 7:144403696-144403718
Sequence GGCCGCGGCGGCGGGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 500}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033756929_1033756940 18 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756940 7:144403737-144403759 GCGGCCTAATGAAGCCTCGCCGG No data
1033756929_1033756941 19 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756941 7:144403738-144403760 CGGCCTAATGAAGCCTCGCCGGG 0: 1
1: 0
2: 1
3: 1
4: 26
1033756929_1033756945 27 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756945 7:144403746-144403768 TGAAGCCTCGCCGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 112
1033756929_1033756935 -6 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756935 7:144403713-144403735 GCGGCCGGCCCGTGATGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1033756929_1033756937 -1 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756937 7:144403718-144403740 CGGCCCGTGATGCACAGGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 44
1033756929_1033756944 23 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756944 7:144403742-144403764 CTAATGAAGCCTCGCCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1033756929_1033756943 22 Left 1033756929 7:144403696-144403718 CCTGGACTCCCGCCGCCGCGGCC 0: 1
1: 1
2: 7
3: 58
4: 500
Right 1033756943 7:144403741-144403763 CCTAATGAAGCCTCGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033756929 Original CRISPR GGCCGCGGCGGCGGGAGTCC AGG (reversed) Intronic
900005141 1:40371-40393 GGCTGCGGCAGAGGGAGTCAGGG - Intergenic
900214145 1:1472134-1472156 GGCCGGGGAAGCGGGAGCCCTGG + Intronic
900221693 1:1512518-1512540 GGCCGGGGAAGCGGGAGCCCTGG + Intronic
900414870 1:2530314-2530336 GGCCGCGGCGCCCGGACTCCAGG - Intergenic
900671336 1:3856906-3856928 GGCCGCGGCAGCGCCAGTCGGGG - Exonic
901086286 1:6614028-6614050 GGCGGCGGCTGCGAGAGTGCAGG - Exonic
901462601 1:9400610-9400632 GGCCTGGGAGGCGGGAGGCCAGG + Intergenic
901531092 1:9852927-9852949 GGCTGTGGAGTCGGGAGTCCTGG - Intronic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902415632 1:16237107-16237129 GGCTGGGGCGGCGGGAGTGCGGG - Exonic
902896895 1:19485442-19485464 GGCGGCGGCGGCGGCGGTCCCGG + Exonic
902916698 1:19644135-19644157 CGCCGCGGCGGCAGGGGCCCCGG - Intronic
903072198 1:20732045-20732067 GGCTGCGGCGGCGGGAGACGCGG - Intronic
903349828 1:22710938-22710960 GGCCGCGGCGCCGCGGGGCCCGG - Intronic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
904672895 1:32179607-32179629 GGCCTCGGAGGCGGGCGCCCCGG - Intergenic
904724877 1:32539660-32539682 GGCCCGGGCGGCGGCAGTGCTGG + Intronic
904769104 1:32871019-32871041 GGCAGCGGGGGCGGGAGTGGGGG - Intronic
904822823 1:33256442-33256464 GGCGGCGGCGGCGGGAGGCTGGG - Intergenic
905625997 1:39491177-39491199 GGCCGCGGTGGCCGGAACCCGGG + Intergenic
906650360 1:47508456-47508478 GGCCGCCGCGGCCGCAGGCCCGG + Intergenic
907278079 1:53327920-53327942 GGGCGCGGCGGCCGGAGCCCCGG - Exonic
907474613 1:54697480-54697502 GGCCTTGGGGTCGGGAGTCCTGG + Intronic
908714300 1:67053784-67053806 GGCCGAGGCGGCGGCGGCCCAGG - Intronic
910760951 1:90730519-90730541 TGCGGCTGCGGCGGGAGTGCGGG - Intergenic
913979475 1:143497119-143497141 AGCCGCGGCGGCGGGGGGGCGGG - Intergenic
914197331 1:145454417-145454439 GGCCGGCGGGGCGGGGGTCCCGG - Intergenic
914889759 1:151612259-151612281 GGCGGCGGCGGCGGGGGGTCTGG + Exonic
915070491 1:153261679-153261701 GGCGGGGGCGGCGGGAGCTCCGG + Exonic
915345561 1:155195249-155195271 GGCCGGGGGGGCCGGAGGCCGGG - Intergenic
915511344 1:156388560-156388582 GGCGGCGGCGGCGGGCGCACGGG - Intergenic
915953496 1:160205426-160205448 GGCGGCGGCGGCGGGAGCCGAGG + Exonic
916656009 1:166876024-166876046 GTCCGCGGCGGCGGGGCTTCGGG - Intronic
917975090 1:180233259-180233281 GCCTGCGGGGGCGGGAGGCCGGG - Intronic
918388760 1:184037052-184037074 GGCCGCCGCGGCGGGACGCGGGG - Intronic
919110894 1:193217465-193217487 GGCCACAGCGGCTGGACTCCAGG - Intronic
919748619 1:201023452-201023474 GGCTGCGGCTGCGGGAGGCGGGG + Exonic
919926345 1:202193835-202193857 GGCGGCGGCGGTGGGAGCGCCGG - Intergenic
920394166 1:205631810-205631832 AGCCGCGGCGGCGGGAGATGCGG - Exonic
920394190 1:205631865-205631887 GGCAGCGGCGGCGCGGGTCTTGG + Exonic
920912677 1:210233033-210233055 GGCCGCGGGGGCGGGAGGGCCGG + Intronic
921472669 1:215567561-215567583 GGCGGCGGCGGCCGGAGGGCGGG - Exonic
922287736 1:224183946-224183968 GGCGGGGGCGGCCGCAGTCCCGG + Intronic
922950969 1:229558420-229558442 GGCTGCCGGGGCGGGGGTCCGGG - Exonic
924172610 1:241357339-241357361 GGGCGCGAGGGCGGGAGGCCGGG - Intergenic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1064209083 10:13348120-13348142 GGCGGCGGCGGCGGGGGCCCGGG + Exonic
1064233124 10:13547518-13547540 GGCCGAGGCGGGTGGAGTTCAGG + Intergenic
1065101347 10:22335598-22335620 GGCCGCGGAGGAGGAAGGCCAGG - Intergenic
1065520539 10:26567183-26567205 GGGGGCGGCGGCGGGAGCTCAGG - Exonic
1066464213 10:35639472-35639494 GGCGGCGGCGGCGGGGGACCCGG - Exonic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1070812057 10:79303225-79303247 GGAGGCCGAGGCGGGAGTCCAGG + Intronic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072336556 10:94403093-94403115 GGCGGCGGCGGCGCGACTCCCGG - Exonic
1072891519 10:99329396-99329418 GGCCGCGGCGGCGGCAGCAGCGG + Exonic
1073112926 10:101073539-101073561 GGGAGGGGCGGCGGGAGTCGGGG - Intergenic
1073812397 10:107164825-107164847 GGACGCGGCGCCCGGAGTCCCGG - Intergenic
1074169723 10:110919960-110919982 GGCGGCGGCGGCGGGCGGCCCGG + Intronic
1075519695 10:123136226-123136248 GGCGGCGGCGGCGGCAGCCGAGG - Exonic
1076817736 10:132923038-132923060 GGCCACGGCGGCAGGGGTCGGGG + Intronic
1077063414 11:627293-627315 GGCGGAGGGGGCGGGAGGCCGGG - Intergenic
1077500887 11:2909361-2909383 GGCCGGGGGGACTGGAGTCCAGG + Intronic
1077609948 11:3637876-3637898 GACCGGGGAGGCGGGAGGCCGGG + Intergenic
1078594419 11:12674478-12674500 GGCCGCGGCGGCGGCAGCAGAGG - Intergenic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079163137 11:18012866-18012888 GGCCGCGGCGTGGGCAGTTCAGG - Intronic
1080458439 11:32434939-32434961 GGCGGCGGCGGCGGGGGTGGCGG + Exonic
1081812904 11:45923180-45923202 GGCCCTGGCGGCGGGAGTCCTGG + Intronic
1082003738 11:47408635-47408657 GGCGGCGGCGGCGGCGATCCGGG - Exonic
1082059483 11:47848297-47848319 GATGGCGGCGGCGGGAGCCCTGG - Exonic
1082789141 11:57335458-57335480 GGCCGCTCCGGCGGGAGCCATGG + Intronic
1082816864 11:57514951-57514973 GGCCGCGGCGGGGGGAGCTGGGG - Intronic
1083033489 11:59615490-59615512 CGCGGCGGCGGCGGGAGGCCCGG - Exonic
1083309591 11:61777511-61777533 GGCCGCGGGGGCGGGGCTCCTGG + Intronic
1083562182 11:63681709-63681731 CCCGGCGGCGGCGGGAGCCCAGG + Exonic
1083623652 11:64060943-64060965 GGCGGCGGCGGCGGGGCTCCCGG + Intronic
1084151354 11:67289316-67289338 GGCGGCGGCGGCGGCAGCGCGGG - Exonic
1084481072 11:69420588-69420610 GCCCGTGGGGACGGGAGTCCTGG - Intergenic
1088462293 11:110093707-110093729 GGCCGCGGGGCCGGGAAGCCCGG - Intronic
1090635802 11:128689862-128689884 GGCCGCGGCGGCGGGAGGGCCGG - Intronic
1090788470 11:130069988-130070010 GGCTGCGGCGGCCGCGGTCCCGG - Exonic
1090799133 11:130159874-130159896 GGCGCAGGCGGCGGGATTCCGGG - Exonic
1090817785 11:130314445-130314467 GGCGGCGGCGGCGGCGGCCCGGG + Exonic
1091498305 12:991248-991270 GGCGGCGGCGGCGGTAGTGGCGG + Intronic
1091558652 12:1594358-1594380 GGCGGCGGCGGCCGGCCTCCGGG - Intronic
1091759460 12:3077391-3077413 GGCGGCGGCGGCGGCGGTGCCGG + Exonic
1091823163 12:3491288-3491310 GGCGGCGGCGGCGGCGGTCGCGG - Exonic
1091986183 12:4911346-4911368 GGGCGCGGGGGTGGGAGGCCAGG - Exonic
1093435390 12:19129914-19129936 GCCCGCGGGGGCGGGAGGGCAGG + Intronic
1095752375 12:45727555-45727577 CGGCGCGGCGGCAGGAGCCCGGG + Intergenic
1096156035 12:49342111-49342133 GGCCGCCGGGGAGGGAGTGCAGG - Intergenic
1096178686 12:49539157-49539179 GGCCGCGGGGCCTGGAGCCCGGG + Exonic
1096241178 12:49961300-49961322 GGCGGCGGGGGCGGGCGGCCGGG - Intergenic
1096309129 12:50505008-50505030 GGCGGCGGCGGCGGCGGTGCTGG + Intronic
1096389401 12:51217477-51217499 GGCCGGGGCGGCGGGATGCTGGG - Intronic
1096593079 12:52675329-52675351 GGCGGCGGCGGCGGCAGCTCTGG - Exonic
1096983752 12:55743427-55743449 GGCGGCAGCGGCGGGGGTCGGGG + Exonic
1097046293 12:56189624-56189646 GGGCGCGGCGGCGGAGCTCCAGG + Intergenic
1097218209 12:57430682-57430704 GGCCGAGGGGGCGGGCGGCCCGG - Intronic
1097981443 12:65741452-65741474 TGCCGCGGCGGCCGGAGCCCGGG + Intergenic
1098161031 12:67648632-67648654 GGCCGCGGCCGGGGGAGCCGGGG + Intronic
1100331403 12:93585801-93585823 GGGGGCAGGGGCGGGAGTCCTGG - Intergenic
1102101513 12:110281747-110281769 GGCCGCGGGGACGGGAGGCGAGG + Exonic
1102371017 12:112382320-112382342 GGCGGCGGCGGCGGCAGGGCCGG - Intronic
1103120018 12:118372591-118372613 AGCCGAGGCGGCGGGACCCCAGG - Intronic
1103563276 12:121803678-121803700 GACCGCCGCGGCGTGCGTCCCGG - Intergenic
1103764803 12:123272071-123272093 CGCGGCGGCTGCGGGAGGCCAGG + Exonic
1104602451 12:130162675-130162697 GGCCGCTGCGCCGGGAGCTCCGG + Exonic
1104841494 12:131828159-131828181 GGGCGCGGAGGCGGGGGTCGGGG - Intergenic
1104933418 12:132352270-132352292 GGCCGCGGCTGCTGGTGTCCTGG + Intergenic
1105000650 12:132687837-132687859 GGCCGCAGCGGCGCGGGGCCTGG + Intronic
1105012685 12:132766287-132766309 GGCCGCGGAGATGGGTGTCCTGG + Intergenic
1105472075 13:20703744-20703766 GGCGGCGGCGGCGGGGGCCGGGG + Intronic
1105691898 13:22848969-22848991 GGCCGGGGCTGCGGAAGCCCTGG - Intergenic
1106226345 13:27789843-27789865 GGCCGCGGGGTGGGGAGGCCGGG + Intergenic
1106227090 13:27793790-27793812 GGCGGCGGCGGCGGGGGTGCCGG + Exonic
1106478034 13:30114812-30114834 GGCGGCGGCGGCGGGGGTGGCGG + Intergenic
1107624845 13:42272060-42272082 GGCGGCGGCGGCGGAAGCCGAGG + Intergenic
1107851502 13:44576843-44576865 GGCGGTGGCAGCGGGAGCCCAGG + Intronic
1107851763 13:44577778-44577800 GGCGGAGGCGGCGGGAGCGCCGG + Intergenic
1111396064 13:87671790-87671812 GGCCGCGGCGGCGGCGGGCTCGG + Intergenic
1111676813 13:91398663-91398685 GGCGGCGGCGGCGGCAGTGGCGG + Exonic
1112271599 13:97975233-97975255 GGCCGAGGCGGGGGGAGGGCGGG + Intronic
1112402123 13:99086491-99086513 GGCTGCGGCGGCCGGACTCGCGG - Intronic
1112402211 13:99086742-99086764 GGCCGCCGCGGCGGGACGGCGGG + Intergenic
1113085713 13:106567755-106567777 GGAACCGGCGGCGGGAGTCGCGG - Exonic
1113378408 13:109783957-109783979 GGCGGCGGCGGCGGCGGCCCTGG + Exonic
1113541869 13:111115441-111115463 GGCGGCGGCGGCGGGGGCCGCGG + Exonic
1113656120 13:112068570-112068592 GGCCGCGTCGTCGGGCGCCCTGG + Exonic
1113848572 13:113405410-113405432 GGAGGCGACGGCGGGAGGCCAGG + Intergenic
1113861694 13:113491082-113491104 GGCCGGGAGGCCGGGAGTCCGGG - Exonic
1114037905 14:18646461-18646483 GGCGGCGGCGGCGGCACCCCAGG - Intergenic
1115399313 14:32939402-32939424 GGCGGCGGCGGCGGGAGCAGCGG - Intronic
1116436181 14:44897480-44897502 GGCGGCGGCGGCGGCAGCCCGGG + Exonic
1116835798 14:49768212-49768234 GGCGGCGGCGGCGCGGGCCCGGG - Exonic
1116849355 14:49893084-49893106 GGCAGCGGCGGCGGCAGAACTGG + Exonic
1116905143 14:50396813-50396835 CGCCGCGGCGCCGTGAGTCCCGG - Intronic
1116945181 14:50830250-50830272 GGCCGGGGCGTCGGGGGTACTGG + Intronic
1117391991 14:55271451-55271473 AGCAGCGGTGGCGGGAGGCCTGG - Exonic
1117875890 14:60249616-60249638 GGCGGCGGCGGCGGCAGCCGGGG - Intronic
1118293038 14:64542710-64542732 GGCAGCGGCGGCGGCGGTTCAGG + Exonic
1118350830 14:64971820-64971842 GGCGCCGGAGGCCGGAGTCCGGG - Intronic
1119003895 14:70907497-70907519 GGTCGCGGCGGCGGCAGTGGGGG + Exonic
1119290444 14:73491263-73491285 GGCGGCGGTGGCGGCCGTCCCGG + Exonic
1121312305 14:92941758-92941780 GGCCGAGCCGGCGGGCGGCCTGG - Exonic
1121803861 14:96797497-96797519 GGGCGCGGAGGCGGGCGGCCGGG + Intronic
1122153951 14:99739238-99739260 CGCCGGGGCTGCGGGAGCCCCGG + Intronic
1122264147 14:100538913-100538935 GGCCGAGGCGGCGGCCTTCCCGG - Exonic
1122866091 14:104604624-104604646 GGCAGCGGCCGCGGAAGTCGTGG + Exonic
1122975250 14:105168321-105168343 GGCGGGGGCGGCGGGGGTCGCGG - Intronic
1122975346 14:105168596-105168618 GGCCTGGGCGGCGGGCGTGCAGG + Exonic
1123037983 14:105479066-105479088 GGGGGCGGGGGCGGGGGTCCGGG - Intronic
1123412921 15:20074086-20074108 GGCCGGGGTGGCGGGAGGGCCGG + Intergenic
1123522263 15:21081199-21081221 GGCCGGGGTGGCGGGAGGGCCGG + Intergenic
1124469308 15:29968922-29968944 GGCGGCGGGAGCGGGAGCCCGGG - Intergenic
1124469330 15:29968995-29969017 GGCGGCGGCGGCGGGAGCTGCGG - Intergenic
1125664165 15:41417148-41417170 GGCGGCGGCGGCGGCAGTGGCGG + Exonic
1125685116 15:41559285-41559307 AGCGGCAGCGGCGGGAGCCCCGG - Exonic
1125950302 15:43746271-43746293 GGCCGAGGCGGCGAGTGTCTGGG - Intergenic
1126034961 15:44537206-44537228 GGCGGCGGCGGCGGGGGACTCGG + Exonic
1127165775 15:56243813-56243835 GGCCGCGGCGGCGGCGGGGCCGG - Intergenic
1127674838 15:61229007-61229029 GGAGGGGGCGGCGGGAGCCCGGG - Intronic
1128374415 15:67065403-67065425 GACCCGGGCGGCGGCAGTCCTGG - Intronic
1129387054 15:75202027-75202049 GGTAGCGGCGGCGGGAGTCCTGG + Intronic
1129844005 15:78759988-78760010 GGGGGCGGTGGCGGGAGTCGGGG - Intronic
1130076529 15:80695078-80695100 GGCGGCGGCGGCGGGCGTGCGGG + Intronic
1130076687 15:80695608-80695630 GGCGGCGGCGGCGGTAGCCTGGG - Exonic
1130115596 15:81002089-81002111 GGCTGCGGCGGCGGGAGCCCGGG - Exonic
1130257801 15:82333812-82333834 GGGGGCGGTGGCGGGAGTCGGGG + Intergenic
1130597135 15:85256151-85256173 GGGGGCGGTGGCGGGAGTCGGGG - Intergenic
1130945344 15:88546627-88546649 AGCCGCGGGTGCAGGAGTCCTGG - Exonic
1131832317 15:96361545-96361567 GGTCCCGGCGGCGGCAGCCCGGG + Intergenic
1132368656 15:101277414-101277436 GGCGGCGGCGGCGGCGGTCATGG - Exonic
1132448372 15:101950573-101950595 GGCTGCGGCAGAGGGAGTCAGGG + Intergenic
1132466208 16:78399-78421 GGCCGCGGGAGCGGGAGTGCCGG + Intronic
1132687400 16:1168121-1168143 GGGCACGGTGGCGGGAGACCAGG + Intronic
1132741276 16:1414532-1414554 GGCGGAGGCGGCGCGAGCCCCGG + Intronic
1132815901 16:1826474-1826496 GGCCGCGGCGGACGCAGGCCTGG + Intronic
1132821178 16:1872024-1872046 GGCCGCGGCGGCAGCTGTGCAGG - Exonic
1132877931 16:2148564-2148586 GGCGGCGGCGGCGGGAGGCCGGG + Intronic
1133051604 16:3120277-3120299 GGCGGCGGCGGCGGGGGCTCTGG + Exonic
1133156349 16:3879798-3879820 GTCCGGGGCGGCGGGGGCCCGGG - Intronic
1133241457 16:4416589-4416611 GGCCGAGGCAGCGGGAGTCGCGG - Exonic
1133933721 16:10252389-10252411 AGCCGCCGCGGCGGCAGCCCGGG - Intergenic
1134157048 16:11852159-11852181 GGCCGAGGCGGAGGGATTCCAGG + Intergenic
1134539931 16:15056029-15056051 GGCGGGGGCGGCGGGCGGCCCGG - Exonic
1134614839 16:15643105-15643127 GGCGGCGGCGGCGGGAGCTGCGG - Exonic
1135382757 16:22008197-22008219 GGCAGCGGCGCGGGGACTCCGGG + Exonic
1135994360 16:27237238-27237260 GGCCTCGGCGGCTGGAGAGCAGG + Intronic
1136003681 16:27314208-27314230 GGCAGCGGAGGCGCGAGGCCCGG + Intronic
1136428285 16:30183504-30183526 GGCGGCCGCAGCGGGAGCCCGGG + Exonic
1136519380 16:30786458-30786480 GGCCGAGGCGCTGGGAGCCCAGG + Intronic
1136546539 16:30958038-30958060 GGCAGCGGCAGCGCGAGACCCGG - Intronic
1137261114 16:46830946-46830968 GCCGGCGGCGGCGGGGATCCGGG - Intronic
1137328078 16:47461353-47461375 GGCGGGGGCGGCGGGACTCACGG + Exonic
1137426683 16:48385792-48385814 GGCCGCGGCGGCGGCCAGCCTGG - Intronic
1137617791 16:49857313-49857335 GGCGGCGGCGGCGGCAGGCACGG + Intronic
1137665277 16:50246049-50246071 GGGCGCGGGGGCGGGAGCCGGGG - Intergenic
1137708030 16:50548674-50548696 GGCGGCGGCGGCGGCAGCCGCGG - Intronic
1139390603 16:66604783-66604805 GGCGGCGGCGGCGGTAGGGCCGG - Exonic
1139446307 16:67000787-67000809 GACCGCGGGCGCGGGAGACCTGG - Intronic
1139750535 16:69106749-69106771 GGCCGCGGCAGCACGTGTCCGGG + Intronic
1140223114 16:73058196-73058218 GGCGGCGGCGGCGCGGGGCCGGG + Intronic
1140442581 16:74999153-74999175 GGCCGCGGCGCTGGGCGGCCAGG - Exonic
1140476766 16:75242854-75242876 GGCCGGGGTGGCGGGAGGGCCGG + Exonic
1141054637 16:80804078-80804100 GGCGGCGGCGGCGGGCGGCGGGG - Intronic
1141432767 16:83979422-83979444 GGCTGCGGCTGAGAGAGTCCTGG + Intronic
1141709136 16:85687942-85687964 CGCCTCGGCGCTGGGAGTCCTGG - Intronic
1142799712 17:2337554-2337576 GGCGGCGGCGGCGGCGGGCCGGG + Exonic
1142990072 17:3724355-3724377 GGCTGAGGCGGCCGGAGTCGCGG - Exonic
1143155533 17:4833777-4833799 CCCAGCCGCGGCGGGAGTCCGGG - Intronic
1144682746 17:17206238-17206260 GGCCGCGGCGGCTGTGGGCCTGG - Exonic
1144725352 17:17499118-17499140 GGCCCAGGCGGCGGGAGTGCTGG - Intergenic
1145126017 17:20300700-20300722 TGCCACGGCTGCGGGAGGCCTGG - Intronic
1145306843 17:21680120-21680142 AGCCGCGGCGGCGGGATCCAGGG + Intergenic
1145925647 17:28644939-28644961 GGCGGCGGCGGCGGGAGGGAGGG - Intronic
1146058651 17:29593402-29593424 GGCGGCGGCGGCGGGCGGCGCGG - Intronic
1147015818 17:37490259-37490281 GGCCGAGGCTGCTGGAGCCCCGG - Intronic
1147429548 17:40363047-40363069 GGCCGGGGCGCCGGGAGGGCAGG + Exonic
1147486426 17:40819126-40819148 GGACGCGGCGGCGGAAGTTTCGG - Exonic
1147710167 17:42458044-42458066 GGCCGAGGCGGGTGGAGGCCAGG + Intergenic
1147987657 17:44315633-44315655 GGTCGGGGCGGCGGGGGTCAGGG - Intronic
1148122656 17:45221996-45222018 GGCGGTGGCGGCGGGGGTCTCGG - Exonic
1148555845 17:48578087-48578109 GGCGGAGGCGGCGGGGGCCCAGG + Exonic
1148562291 17:48613065-48613087 GGACGCTGCGGTGGGAGGCCCGG + Exonic
1149498910 17:57136524-57136546 GGCCGCAGGGGAGGAAGTCCCGG + Intergenic
1149712565 17:58756303-58756325 GGCGACGGCGGCGGCAGCCCCGG + Exonic
1150137638 17:62704308-62704330 GGCTGCGGAGGCTGGAGGCCCGG + Intronic
1150675747 17:67245034-67245056 GGCCGCCGCGCCCGGGGTCCGGG + Intronic
1150692560 17:67378236-67378258 GGCGGTAGCGGCGGGGGTCCCGG - Intronic
1151755331 17:76072439-76072461 GGCGGCGGCGGCGGCAGTGGCGG - Exonic
1151780137 17:76240241-76240263 GGCCGCTGCGGCTGCAGCCCCGG + Exonic
1151828802 17:76537954-76537976 GGCCGGGGCGCTGGGGGTCCCGG + Intronic
1151854306 17:76710546-76710568 GGCAGCGGCAGCCGGAGCCCCGG + Intronic
1152527710 17:80898687-80898709 AGCCGGGGCGGGGGGAGTCGGGG - Intronic
1152616836 17:81341775-81341797 GGCAGCCGCGGCGGGACACCCGG - Intergenic
1152617806 17:81345953-81345975 GGCGGCGGCGGCCGCCGTCCGGG + Intergenic
1152675297 17:81637024-81637046 GGCGGCGGCGTAGGGAGGCCGGG - Exonic
1152728624 17:81959607-81959629 GGCTGAGGCGGGGGGAGGCCGGG - Intronic
1152864983 17:82717010-82717032 AGGGGCGGCGGCGGCAGTCCCGG - Intronic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1153040896 18:812286-812308 GGCCGAGGCGTGGGGAGCCCGGG - Intronic
1153265250 18:3262612-3262634 CGCCGCGGCGCCGGGAGGGCAGG - Exonic
1155054456 18:22171663-22171685 GGCCGCGGCGGCAGCAGCCGCGG + Exonic
1155507647 18:26548462-26548484 GGCGGCGGCGGCGGCAGCGCTGG + Intronic
1155910334 18:31498148-31498170 GGCCGGGCCGGGGGGAGGCCGGG + Exonic
1157384312 18:47248361-47248383 GGCCGCGGTGGCCGGAGGCGGGG - Intronic
1157753010 18:50194977-50194999 CGCCGCCGCGGCGGGAGTAAAGG - Exonic
1158436010 18:57435861-57435883 GGGGGCGGCGGCGGGGGCCCGGG + Exonic
1160297473 18:77651007-77651029 TGCCGCGGCGGGAGGAGACCCGG + Intergenic
1160418149 18:78726392-78726414 GGGCACGGGGGCGGGAGCCCGGG - Intergenic
1160636895 19:81980-82002 GGCTGCGGCAGAGGGAGTCAGGG - Intergenic
1160719165 19:590003-590025 GGCGGCGGCGGCGGCGGCCCCGG - Exonic
1160724233 19:610581-610603 GGCGGGGGTGGCGGGGGTCCTGG - Intronic
1160736082 19:663014-663036 GGCCGGGGCGGCGGGCGGCAGGG - Intronic
1160796572 19:948415-948437 GACCGCGGCCCCGGGAGGCCGGG - Intronic
1160853621 19:1206249-1206271 GGCCGCGGCGGGAGGCCTCCCGG + Intronic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160917926 19:1506623-1506645 GGGCGCGGCCGCGGGTGTCAGGG + Exonic
1160960507 19:1718727-1718749 GGCAGGGGCGTCGGGAGCCCTGG - Intergenic
1161309361 19:3585552-3585574 GGCGGCGGCGGCGAGGGCCCGGG + Exonic
1161333775 19:3700267-3700289 GGCCGCAGCCCCGGGAGGCCGGG + Intronic
1161358195 19:3831454-3831476 GGCAGCTGCTGCGGGGGTCCCGG + Exonic
1161575039 19:5050442-5050464 GGCCGGGGGGGCCGGAGTGCAGG + Intronic
1161802642 19:6424565-6424587 GACCGGGGCGGCGGCGGTCCCGG - Exonic
1161924958 19:7293585-7293607 GGGCGCGGAGGCGCGAGCCCGGG + Intronic
1162021157 19:7869229-7869251 GGCGGCAGCGGCGGGGGCCCAGG - Exonic
1162033207 19:7926053-7926075 GGCGGCGGCGGCGGCGGCCCGGG + Exonic
1162535825 19:11262444-11262466 GGCGGCGGCGGCGGGACGCGAGG - Exonic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1162907071 19:13830459-13830481 GGACGCGGCGGCCGGCGGCCTGG + Exonic
1162954227 19:14089708-14089730 GGTGGCGGGGGCGCGAGTCCCGG - Intronic
1163154489 19:15432523-15432545 GGCGGCGGCGGCGGGGGTGGGGG + Intronic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163527721 19:17831367-17831389 GCACGCAGCGGCGGGAGCCCAGG + Exonic
1163557638 19:18001606-18001628 GGTCGCGGCCGAGGGGGTCCCGG - Intronic
1163586951 19:18169347-18169369 GGCTGCGGCGGCGGGAGCCACGG + Exonic
1163715217 19:18869238-18869260 GGCGGCGGCGGCGGCAGCCCCGG - Exonic
1164639260 19:29812357-29812379 GGCGGGGGCGGCGGGACCCCGGG + Intronic
1165073292 19:33267848-33267870 GGGAGCGGGGGCGGGAGTCAAGG - Intergenic
1165305454 19:35000352-35000374 GGCGGCGGCCGCGGAAGGCCAGG + Exonic
1165349519 19:35268504-35268526 GGCGGCGGCGGCGCGAGCCCCGG - Intergenic
1165419915 19:35717679-35717701 GGCCGGGACGGCGGGGTTCCCGG - Intergenic
1166949398 19:46416535-46416557 GGGCGGGGCCGCGGGAGGCCCGG - Intergenic
1166995297 19:46717083-46717105 GGCGGCGGCGGCGGCGGCCCAGG + Exonic
1167001113 19:46746267-46746289 GGCGGCGGCGGAGGCAGCCCCGG - Exonic
1167019086 19:46861074-46861096 GGCTCCGGCGGCGGGGGGCCGGG - Intergenic
1167080776 19:47274941-47274963 GGCGGCGGCGCCGAGAGCCCCGG + Exonic
1167258103 19:48443018-48443040 GGCCGCGGCGGCGGGGGGCGCGG - Exonic
1168247003 19:55117486-55117508 GGCGGCGGCGGCGGCTGCCCGGG - Exonic
1168293852 19:55369593-55369615 GGCCGCGGGAGCGGGAGAGCTGG + Intronic
1168307218 19:55442319-55442341 GGCCGCGGGGGCGAGGGCCCCGG - Exonic
1168309046 19:55451640-55451662 GGCGGGGGAGGCGGGGGTCCGGG - Intergenic
1168401556 19:56088394-56088416 GGCCGCGGCCGCGGCAGCCATGG - Exonic
925376369 2:3388677-3388699 GGCTGCGGAGGTGGGAGACCCGG - Intronic
925609793 2:5693151-5693173 GGCGGCGGCGGCGGGAGCGCGGG + Exonic
925984720 2:9206708-9206730 GGGCGGGGCGGCGGGAGGACCGG - Intergenic
926305412 2:11634368-11634390 GGCAGAGGCGGCGGCAGCCCTGG + Intronic
926980255 2:18560542-18560564 GGCCACTGCGGCGGCAGTACTGG - Exonic
927881459 2:26692716-26692738 GGCGGCGGCGGCGGCGGCCCCGG + Intronic
928421116 2:31138386-31138408 GGCGGCGGCGGCGGCAGCCGCGG - Intronic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
933666957 2:84971528-84971550 GGGCGCGGCGGAGGGCGGCCGGG + Intronic
933772771 2:85754544-85754566 GGCGGCGGCGTGGGGAGTCCTGG - Exonic
934296812 2:91749012-91749034 GGCGGCGGCGGCGAGGGTGCGGG - Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
934856482 2:97733240-97733262 GGCGGGGGCGGCAGGAGACCTGG + Intronic
935149136 2:100417735-100417757 GGGCGCGGCCGCGGGACCCCAGG + Intergenic
935196637 2:100820230-100820252 CGCCGCGGCTGCGGGTCTCCGGG - Exonic
935410909 2:102760830-102760852 GGCCGAGGCGGGTGGAGACCAGG - Intronic
935592786 2:104856399-104856421 GGCGGCGGCGGCGCGGGGCCTGG + Exonic
935971535 2:108534477-108534499 GGCCGCGGCGGCGAGGGACTAGG + Intronic
937993081 2:127674966-127674988 GGCCGGGGAGGCGGGACTGCGGG - Intronic
938229995 2:129649989-129650011 GGCGGTGGCGGCGGGTGTGCAGG + Intergenic
939900501 2:147844589-147844611 GGCAGCGGCGGCGGCGGTGCAGG - Exonic
940646827 2:156400464-156400486 GGCCACAGCGGCGGGACTCCCGG - Intergenic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
942450901 2:176107587-176107609 GGCGGCGGCGGCGGCAGCGCGGG + Exonic
943645950 2:190408257-190408279 GGTCGCGCCGGCGGGAGCGCTGG + Intergenic
945225868 2:207530471-207530493 GGCGGCGGCGGCGGGAACGCGGG - Intronic
946354925 2:219178487-219178509 GGCCGAGGCGGTGGGACGCCTGG + Exonic
946431004 2:219627481-219627503 GGCCGGGGCGGGGTGAGTCACGG + Intronic
946921403 2:224585105-224585127 GGCGGCGGCGGCGCGACCCCCGG + Exonic
947187991 2:227472183-227472205 GGCGGCGGCGGCGGTTGTCCCGG + Exonic
947213529 2:227729175-227729197 GGCCGAGGCGGGCGGAGTTCAGG + Intergenic
947641342 2:231709315-231709337 GGCCGCGACGTCGGCCGTCCCGG + Intronic
948801684 2:240436093-240436115 GGGCGCGGCGCCGGGAACCCGGG + Intronic
948843750 2:240673049-240673071 GGCAGTGGCGGCGGGTGGCCTGG - Intergenic
948874629 2:240820083-240820105 GGGCGCGGGCGCGGGAGGCCGGG + Intronic
948910259 2:240999121-240999143 GGCGGCGGCGGCGGGAGTCCGGG - Intronic
948933715 2:241149264-241149286 GGGCGCAGGGGCGGGAGACCCGG + Intronic
1168753221 20:298045-298067 GCCGGCGGCGGCGGCAGGCCCGG + Exonic
1169143551 20:3238917-3238939 GGGCGCGGGTGCGGGAGGCCCGG - Intronic
1169193750 20:3672779-3672801 GCCGGCGGCACCGGGAGTCCGGG + Exonic
1172287566 20:33751802-33751824 GGCTGAGGCGGGTGGAGTCCAGG - Intronic
1172408130 20:34704321-34704343 GGCCGCTGCGGCGGGGCTCACGG - Exonic
1172474489 20:35226769-35226791 GGCGGCGGCGGCGGCGGCCCCGG - Exonic
1173672879 20:44810308-44810330 GGCGGCGGCGGCGGGCGGCTTGG + Intronic
1175429103 20:58890248-58890270 GGCCGCGGCGGCGGCGGCCTCGG - Intronic
1175856058 20:62121858-62121880 GGGCACTGGGGCGGGAGTCCCGG + Intergenic
1175889860 20:62311289-62311311 GACGGCTGCGGCGGGAGGCCTGG + Exonic
1175911486 20:62407246-62407268 GGCCGCGGCCGGTGGAGCCCCGG - Exonic
1175921785 20:62453563-62453585 GGCCACTGGGGCGGGAGTCTTGG + Intergenic
1175924941 20:62466978-62467000 GGCCTGGGAGGCGGGTGTCCAGG - Intronic
1175962167 20:62642665-62642687 GCGCGCGGGGGCGGGAGGCCTGG + Intronic
1176029536 20:63005292-63005314 GGCGGCGGGGGGGGGAGGCCAGG + Intergenic
1176085394 20:63293447-63293469 GGCCGGGGCAGTGGGAGCCCGGG + Intronic
1176253695 20:64139567-64139589 GGCCAGGGCGGAGGTAGTCCAGG + Intergenic
1176576575 21:8443306-8443328 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1179178937 21:39028960-39028982 GGCCGTGGGGGCGGGTGCCCAGG - Intergenic
1179213613 21:39348731-39348753 GGCCGCGGGGGCGGGCGTTCTGG - Intronic
1180143625 21:45907849-45907871 GGACGGGGCGGGGGGAGTGCTGG + Intronic
1180462032 22:15573503-15573525 GGCGGCGGCGGCGGCACCCCAGG - Intergenic
1180534542 22:16386773-16386795 AGCCGCGGCGGCGGGGGTGGGGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180951451 22:19722357-19722379 GGCGGCGGAGGCGGGCGTCAGGG + Intronic
1180962109 22:19766752-19766774 GGCCGCGGCGGCTGGACTCACGG - Exonic
1181026820 22:20131719-20131741 GGCCGCGGCGGGGCGGGACCGGG - Intronic
1182000078 22:26913111-26913133 GGCAGAGGCGGCGGGAGGCGGGG + Intergenic
1182355436 22:29720545-29720567 GGCCGCCGGGGCGGGGATCCCGG - Intronic
1182804466 22:33058417-33058439 CGCCGCGGCGCGGGGAGGCCGGG - Intergenic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183247221 22:36703250-36703272 GGCGGCGGCGGCGGCAGGGCGGG + Exonic
1183540518 22:38426929-38426951 GGCCGCGGTGGCCGCAGGCCTGG - Exonic
1183622479 22:38982542-38982564 GGCAGGGGCGGGGGGAGGCCAGG - Intronic
1183641816 22:39097416-39097438 GGCTGGGGCAGCGGGAGGCCAGG - Intronic
1183856201 22:40636645-40636667 GGCCGCGGCGGCGAGAGCGACGG - Exonic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185171730 22:49298233-49298255 GGCTGCGGCGGGGGCAGTCAAGG + Intergenic
1185349470 22:50327020-50327042 GGCGGGGGCGGCGCGCGTCCGGG + Exonic
1185374295 22:50474977-50474999 GGCGGCGGCGGCGGCGGCCCAGG + Exonic
1185397646 22:50600952-50600974 GGCGGCGGGGACGGGGGTCCGGG - Intronic
1203254625 22_KI270733v1_random:132364-132386 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203262681 22_KI270733v1_random:177443-177465 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
949709947 3:6861472-6861494 GGCGGCGGCGGCGCGCGGCCAGG + Exonic
950416030 3:12869440-12869462 GGGCCCAGCTGCGGGAGTCCTGG - Intronic
950829405 3:15859572-15859594 GGCGGCGGCGGCGGGCGGCCGGG - Exonic
951543651 3:23806163-23806185 GGCCCCGGCGGCGCGAGTCGGGG - Intronic
951907967 3:27722194-27722216 GGCGGCAGCGGCGGGAGCGCTGG - Exonic
952382893 3:32818207-32818229 GGGGGCGGCGGCGGGGGCCCTGG + Exonic
952867195 3:37862009-37862031 GGCGGCGGCGGCGGGAGCTGGGG + Intronic
953680685 3:45035960-45035982 GGCAGGGGCCGCGGGAGGCCGGG + Exonic
954316233 3:49803242-49803264 GGCGGCGGCGGCGGGAGCTACGG + Exonic
954618604 3:51983293-51983315 GGCCGCGGCGGCCGCTGCCCGGG + Exonic
954632918 3:52056616-52056638 GGCCGCGGGGGCCGGCGCCCGGG + Intergenic
955368875 3:58333381-58333403 GGCGGGGGCTGCGGGATTCCCGG + Intronic
956659151 3:71582361-71582383 GGCGGCGGCGCCGGGAGCCGAGG - Intronic
956678025 3:71753677-71753699 GGCAGCGGCGGCGGCGGGCCCGG + Intronic
957792486 3:84959056-84959078 GGCAGCGGCGGCGGCAGTGGCGG - Intronic
961408875 3:126704217-126704239 TGCCGCGGCCGCGCGAGTCCTGG + Exonic
961484902 3:127209738-127209760 GGCCCCGGAGGCTGGAGTGCAGG + Intergenic
961551564 3:127672881-127672903 GGCCGCGGGGCGGGGAGGCCGGG + Intergenic
961551665 3:127673228-127673250 GGGGGCTGCGGCGGGGGTCCGGG - Intronic
961735858 3:129001823-129001845 GGCCGGCGCCGCGGCAGTCCAGG - Exonic
962793905 3:138834698-138834720 GGCGGCGGCGGCGGAACGCCAGG - Intronic
963189015 3:142448128-142448150 GGCCCCGGCCGCGCGAGGCCCGG - Intergenic
963607188 3:147421378-147421400 GGAGGCGGCGGCGGGAGTGCGGG + Intronic
965881726 3:173395882-173395904 GGAGGCAGCGGAGGGAGTCCTGG + Intergenic
966820112 3:183917542-183917564 GCCCGAGGGGGCTGGAGTCCAGG + Intergenic
966831968 3:184017656-184017678 GGAGGCGGCGGCAGGAGACCAGG + Intronic
966911393 3:184562170-184562192 GGCCGCGCCGGCGGGGCTGCAGG - Exonic
967171754 3:186827442-186827464 GGCCGCGGCGGCGGCAGAAAGGG + Intergenic
967859686 3:194141551-194141573 GGCGGCGGCGGCGGGAGGCCGGG + Intergenic
968131615 3:196195781-196195803 GGCCACGGGGGAGGGGGTCCAGG - Intergenic
968135569 3:196217273-196217295 GGAGGCTGAGGCGGGAGTCCAGG + Intronic
968434106 4:576189-576211 GGCGGCGGCGGCGCGGGCCCGGG - Intergenic
968512285 4:1001017-1001039 GGCCGGGGCGGGGGTACTCCTGG + Intronic
968556230 4:1247798-1247820 GGCCGAGGCGGCGGGTGCGCAGG - Intronic
968647374 4:1747496-1747518 GTCCGGGGCTGCGGAAGTCCAGG - Intergenic
968701278 4:2059339-2059361 GGCGGAGGCGGCGGGCGGCCGGG - Intergenic
968701291 4:2059369-2059391 GGCGGCGGCGGCGGCAGCTCAGG - Intergenic
968775380 4:2536812-2536834 GGCCGCGGCGGCGGGCGCTCCGG - Intronic
969214072 4:5708940-5708962 GAGCGCGGGGCCGGGAGTCCTGG + Intronic
969330259 4:6470751-6470773 GGCCGCGGCTTTGGGAGGCCCGG - Intronic
969413342 4:7043438-7043460 GGCCGCGGTGGCGGCAGCCGCGG + Exonic
970195216 4:13544915-13544937 GGCGGCGGCGGCGGTAGCCGCGG + Exonic
970824038 4:20252426-20252448 TGACGCGGCGGCCGCAGTCCCGG - Intergenic
971244073 4:24912894-24912916 GGAGGAGGCGGCGGGGGTCCAGG - Intronic
971457933 4:26861322-26861344 GGCCGCCGCGGCGGGAGAGGAGG - Exonic
972533046 4:39977551-39977573 GGCGGCGGCGGCGGGACCCGCGG - Exonic
973339146 4:48986338-48986360 GGACGCGGCGGCGGGAACCTGGG + Exonic
973764268 4:54149369-54149391 GGGCGGGGCGGCGGGGCTCCGGG + Intronic
975342637 4:73258791-73258813 GGCGGCGGCGGCGGCAGTAGAGG - Intronic
976246469 4:83010792-83010814 GGCGGCGGCGGCGGCGGCCCGGG - Exonic
980075273 4:128287705-128287727 GACGGCGGCAGCGAGAGTCCAGG - Exonic
985723437 5:1502563-1502585 GGCCGAGGCTGCGGGATCCCAGG + Intronic
985894264 5:2739615-2739637 GGCGACGGCGGCGGGGGTTCAGG - Intergenic
987373963 5:17217616-17217638 GGCGGCGGCGGCGGCAGTAGCGG + Exonic
988722458 5:33892206-33892228 GAGCGCGGGGGTGGGAGTCCGGG - Intergenic
988796448 5:34656800-34656822 GGCCGCGGCGGAGGGAGCGCGGG + Intronic
989103324 5:37839684-37839706 GGCGGCGGCGGCGGGAGTCTTGG - Intronic
991054561 5:62306742-62306764 GGCCGCGGGGGAGGGAAGCCGGG + Intronic
992529179 5:77638860-77638882 GGAGGCGGCGGCGGCAGCCCTGG + Exonic
994075728 5:95647136-95647158 GGCCGGGGCTGCGGAAGCCCTGG - Exonic
994107321 5:95961731-95961753 GGCGGCGGCGGCGGCACCCCGGG - Exonic
997265000 5:132490356-132490378 GGCCGCGGCGCGGGGAGGGCGGG - Intronic
997568177 5:134905237-134905259 GGCCGCGTGGGTGGGGGTCCGGG + Intronic
997585216 5:135039780-135039802 GGCGGCGGCGGCGGGAGGAGCGG - Intronic
998200489 5:140114314-140114336 GGCGGCGGCGGCGGGGCCCCAGG + Exonic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999748708 5:154610642-154610664 GCCCGCGGCGGCGGGGGTTGGGG - Intergenic
1001688741 5:173616405-173616427 GGCGGCGGCGGCGGGGGAACTGG - Exonic
1002186038 5:177455275-177455297 GGCTGCGGCGGCGCCAGGCCCGG - Exonic
1002261027 5:177994231-177994253 GGTGGCGGCGCCGGGAGTGCGGG + Exonic
1002368173 5:178729444-178729466 GGCCGTCGTGGTGGGAGTCCCGG - Intronic
1002385152 5:178860604-178860626 GGCCGTCGTGGTGGGAGTCCCGG + Intronic
1002455868 5:179345142-179345164 GGCCAGGCCGGCGGGGGTCCCGG + Intronic
1002512748 5:179733357-179733379 GGCCGGGGCGGCGGGCGCCGGGG - Exonic
1002524239 5:179806670-179806692 GGCGGCGGCGGCAGGGGCCCCGG + Intronic
1002896618 6:1383579-1383601 GGCTGCGGCGGCGGGAGGGAGGG - Intergenic
1004204023 6:13574766-13574788 GGTCGCTGCGGCTGGAGACCAGG + Intronic
1004396127 6:15248137-15248159 GGCGGCGGCTGCGGGAGGCACGG + Intronic
1004516882 6:16328129-16328151 GGCCACGGGGGCGGGAGGCATGG - Exonic
1005832391 6:29681139-29681161 GGCCGCGGCGCCGGGACTGCGGG - Intergenic
1006491587 6:34392539-34392561 GGCAGCGGCGGCGCGGGACCTGG - Exonic
1007614400 6:43171747-43171769 GGCGGCGGCGGCGGGACACGCGG + Exonic
1007739137 6:44000505-44000527 GCCTGCCGCGGCGGGAGTGCTGG - Intergenic
1007781554 6:44257472-44257494 GGAGGCGGCGGCGGGAGCGCAGG - Exonic
1008629403 6:53348861-53348883 GGCGGCGGCGGAGGGAGCGCGGG + Exonic
1011416252 6:87122770-87122792 GGCGGCGGCGGCGGCGGGCCTGG + Intergenic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1013330328 6:109094625-109094647 GGCCGCAGCGGCCGGAGGCTTGG + Exonic
1014137534 6:117907170-117907192 GGCGGCGGCGGCGGCAGAGCGGG - Intergenic
1014246827 6:119078540-119078562 GGCGGCGGCGGCCGGGGGCCGGG + Exonic
1016010768 6:139135549-139135571 GGCGGCGGCGGCGGGCGCGCCGG + Exonic
1016590083 6:145735086-145735108 GGCCCCGGCGGCGCGCGTCCCGG - Intronic
1017324697 6:153131401-153131423 GCGCGCGGCCGCGAGAGTCCCGG + Intergenic
1017842433 6:158232458-158232480 GGCGGTGGCTGCGGGAGTCTTGG + Intronic
1018420568 6:163637375-163637397 GGCCGAGGAGCCGGGAGTCCAGG + Intergenic
1019032183 6:169023403-169023425 AGCCGAGGCAGCGGGTGTCCAGG + Intergenic
1019058737 6:169241060-169241082 GGCGGCAGGGGCAGGAGTCCGGG - Intronic
1019061848 6:169262829-169262851 GGCCGCGGGGGCAGGAGGCTCGG - Intergenic
1019325494 7:436369-436391 GGCGGGGGCGGCAGGAGGCCTGG + Intergenic
1019737106 7:2656088-2656110 GGACGCGGAGGAGGGGGTCCTGG - Exonic
1019989612 7:4682456-4682478 GGCGGCGGCGGCGGCGGCCCGGG - Exonic
1020274297 7:6615505-6615527 GGCGGCGGCGGCGGGGGCCGGGG + Intergenic
1022113792 7:27246286-27246308 GTCCGAGGCGGCGGCAGCCCGGG - Exonic
1022396217 7:29989793-29989815 GGCCCCAGCGCCGGGAGTCTGGG - Intronic
1023418144 7:39950832-39950854 GGCTGCGGCGGCGGCCGTGCCGG - Exonic
1023529349 7:41136724-41136746 GGCCGAGGCGGCGGGGGTGCTGG + Intergenic
1023746506 7:43327336-43327358 GGCAGCGGTGGGGGGAGTCTTGG - Intronic
1026360562 7:69598479-69598501 GGCGGCTGCAGCGGGAGCCCGGG - Intergenic
1026521778 7:71124118-71124140 AGCCGAGGCGGGTGGAGTCCAGG - Intergenic
1026923730 7:74174526-74174548 AGCCGGGGCGGCGGGAGGCGGGG + Intronic
1026923760 7:74174614-74174636 GGCGGCGGCGGCTGGGCTCCCGG + Intronic
1027228580 7:76259999-76260021 GGCCGCGGTAGCAGGAGGCCGGG - Exonic
1027228599 7:76260041-76260063 GGCCGCCGCGGCGGGGGTGGGGG + Intronic
1028621425 7:92833328-92833350 CGCCGCGGCGGGCGGCGTCCAGG - Exonic
1029109562 7:98205717-98205739 GGCCGCGGCCGCGGGTGCACGGG - Exonic
1029640402 7:101816396-101816418 GGCGGCGGCGGCGCGGGGCCCGG - Intronic
1029849327 7:103446059-103446081 GGCCGCGGGGCCGGGGGTCGCGG - Intronic
1030138748 7:106284694-106284716 GGTCGCGGCGCGGGGAGGCCCGG - Intronic
1032800060 7:135310624-135310646 GGCAGCTGCTGCGGGACTCCCGG + Intergenic
1033756929 7:144403696-144403718 GGCCGCGGCGGCGGGAGTCCAGG - Intronic
1034455400 7:151167484-151167506 GGGGGCGGCGGCGGGGGCCCGGG - Exonic
1035169754 7:157010783-157010805 GGGCGGGGCGGCGGGCGGCCGGG - Intergenic
1036390285 8:8318847-8318869 GGCGGCGGGGGCGGGAGCCGGGG + Exonic
1036676606 8:10839434-10839456 GGCGGCGGCGGGGCCAGTCCCGG + Intronic
1037529121 8:19757008-19757030 GGCAGCGGCGGAGGGAGGCCAGG + Intronic
1037811439 8:22089317-22089339 GGCCGGGCCGCCGGGAGTCGCGG + Intronic
1037901763 8:22692951-22692973 GGCGGCGGCGGCGGCAGCTCGGG - Exonic
1037928802 8:22865378-22865400 GGTGGCGGCGGCGGGACCCCGGG + Intronic
1039467909 8:37797105-37797127 GGGCGCGGCGGCGGGGACCCCGG + Intronic
1042307178 8:67343863-67343885 TGCCGCGGCGCCGGGAGGCTGGG + Intergenic
1043464036 8:80487189-80487211 GGCGGCGGCGGCGGGGGTCTCGG + Exonic
1045459411 8:102412790-102412812 GGGCGCGGCGGCGAGAGGCGGGG + Exonic
1045738019 8:105318860-105318882 GGCGGCGGCGGCGGGAGCCGAGG + Exonic
1046871300 8:119208394-119208416 GGCGGCGGCGGCAGGAGCCCGGG + Exonic
1046962393 8:120125039-120125061 GGCCGCGGAGGCGGGAGGTGGGG - Intronic
1048072845 8:131040143-131040165 GGCAGCGGCAGCGGGAGTGGAGG - Exonic
1048833307 8:138496771-138496793 GGCGGCGGCGGCGGGCGGACTGG + Exonic
1049237148 8:141518140-141518162 GCCCGCGCAGGCGGGAGACCAGG - Intronic
1049441712 8:142612638-142612660 GGCGGCGGCGCCGGAAGTCGAGG + Exonic
1049473819 8:142787843-142787865 GGCAGCGGCGGCAGGAGGCTGGG - Intergenic
1049662158 8:143824342-143824364 GGCGGCGGCGGCGGCAGTGGTGG - Exonic
1050437926 9:5629189-5629211 GGCGGCGGCGGCGGCAGCTCGGG - Exonic
1052970244 9:34372895-34372917 GGCGGCGGCGGGGGTAGGCCTGG + Exonic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1053435018 9:38068740-38068762 GGCCCCGGCGGGGGGCGTCCGGG + Exonic
1055266314 9:74498827-74498849 GGCGGCGGCGGCGGGACCCCGGG + Intronic
1056659977 9:88536108-88536130 CGCAGCGGCGCCGGGAGTCCAGG - Intronic
1057054196 9:91949112-91949134 GGCCGCGCCGGGGGGACCCCCGG - Intronic
1057297827 9:93859746-93859768 TGGCGGGGCGGGGGGAGTCCAGG - Intergenic
1057490451 9:95516218-95516240 GGCCTCGGGGGCGGGGGCCCGGG + Intronic
1057869711 9:98708688-98708710 GGCGGCGGCGGCGGCGGCCCGGG + Exonic
1058923652 9:109641016-109641038 CGCCGCGGCGGCAGGAGGCAAGG + Intronic
1060105193 9:120868973-120868995 GGCCTCGGGGGCGGGACTCGGGG - Intronic
1060468738 9:123930173-123930195 GGCAGCGGCGGCGGCAGCGCGGG - Intergenic
1060799024 9:126532108-126532130 GGCCCAGGGGGCAGGAGTCCTGG - Intergenic
1060849299 9:126860994-126861016 GCCAGCGGCGCCGGGACTCCAGG - Intronic
1060917119 9:127397922-127397944 TGCCGCGGCGGGGGGAGTGCTGG + Exonic
1060935107 9:127510062-127510084 GGCCCCGGCTGCGTGACTCCGGG - Intronic
1061128066 9:128689308-128689330 GGCGGCGGCGGCGGGCGGCTCGG - Intronic
1061144123 9:128787280-128787302 GGCGGCGGCGGCGGCAGCGCAGG + Exonic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1061321823 9:129835631-129835653 GGCGGCGGCCGGGGGGGTCCCGG - Intronic
1061559778 9:131394612-131394634 GGCCGGAGGGGCGGGGGTCCCGG + Intronic
1061975851 9:134067789-134067811 GGCGGCGGCGGCGGCGGCCCCGG + Intronic
1062325698 9:136011552-136011574 GGCCGCGGCCGCCGGCGTCTGGG + Exonic
1062378765 9:136276773-136276795 GGCAGCGGCGAGGGGAGGCCGGG - Intergenic
1062389244 9:136327498-136327520 GGCCACGGCGGCGGGAGGGGCGG + Exonic
1062544206 9:137054329-137054351 GGCCGTGGAGGCAGGAGACCTGG + Intergenic
1062568519 9:137173838-137173860 GGCGGCGGCTGCAGGAGCCCAGG + Intergenic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1203471026 Un_GL000220v1:115508-115530 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203478847 Un_GL000220v1:159480-159502 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1185482954 X:461160-461182 GGCTGCGGTGGGGGGAGCCCTGG + Intergenic
1187270601 X:17776318-17776340 AGCCAGGGAGGCGGGAGTCCAGG + Intergenic
1187319906 X:18229407-18229429 AGCCAGGGAGGCGGGAGTCCAGG - Intergenic
1189321498 X:40090249-40090271 GGCCTCGGCGGCGGGAGGGACGG + Intronic
1190474406 X:50813143-50813165 GGCGGCGGCGGCGGCAGTGGCGG + Intronic
1190598766 X:52069165-52069187 GGGCGCGGCTGCGGGGTTCCTGG - Exonic
1190610058 X:52184908-52184930 GGGCGCGGCTGCGGGGTTCCTGG + Exonic
1192988658 X:76427945-76427967 GGCGGCGGCGGCGCGAATTCTGG - Exonic
1193380309 X:80809563-80809585 GGCGGAAGCGGCGGGACTCCCGG - Exonic
1196425190 X:115562049-115562071 GGTCGGGGCGGCGGCAGTCCCGG + Intronic
1196762623 X:119213166-119213188 GGCAGTGGAGGCGGGAGGCCGGG - Intergenic
1197415300 X:126166138-126166160 GGCGGCGGCAGCGGTCGTCCTGG + Intergenic
1200084800 X:153598919-153598941 GGCCGCGGCGCCGCCTGTCCTGG + Intronic
1200093818 X:153648025-153648047 GCTCGCGGCTGCGGCAGTCCAGG - Exonic
1200277856 X:154751154-154751176 GGCCGCGGCGGCCGGAGGCGGGG - Intronic
1202115724 Y:21467733-21467755 GAGGGCGGCGGCGGGTGTCCTGG - Intergenic