ID: 1033757027

View in Genome Browser
Species Human (GRCh38)
Location 7:144403951-144403973
Sequence CCCAGGTGCGGGTCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033757013_1033757027 3 Left 1033757013 7:144403925-144403947 CCGCTCCCCCCAGCCAGGAGCCC 0: 1
1: 0
2: 18
3: 102
4: 1249
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757015_1033757027 -2 Left 1033757015 7:144403930-144403952 CCCCCCAGCCAGGAGCCCAGGCC 0: 1
1: 1
2: 13
3: 129
4: 1523
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757011_1033757027 9 Left 1033757011 7:144403919-144403941 CCTGCTCCGCTCCCCCCAGCCAG No data
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757019_1033757027 -6 Left 1033757019 7:144403934-144403956 CCAGCCAGGAGCCCAGGCCCAGG 0: 1
1: 1
2: 18
3: 120
4: 877
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757008_1033757027 25 Left 1033757008 7:144403903-144403925 CCGGGCCTGGGCGCCGCCTGCTC No data
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757009_1033757027 20 Left 1033757009 7:144403908-144403930 CCTGGGCGCCGCCTGCTCCGCTC 0: 1
1: 0
2: 3
3: 33
4: 317
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757007_1033757027 26 Left 1033757007 7:144403902-144403924 CCCGGGCCTGGGCGCCGCCTGCT 0: 1
1: 0
2: 5
3: 49
4: 419
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757016_1033757027 -3 Left 1033757016 7:144403931-144403953 CCCCCAGCCAGGAGCCCAGGCCC 0: 1
1: 2
2: 15
3: 119
4: 823
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757021_1033757027 -10 Left 1033757021 7:144403938-144403960 CCAGGAGCCCAGGCCCAGGTGCG No data
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757018_1033757027 -5 Left 1033757018 7:144403933-144403955 CCCAGCCAGGAGCCCAGGCCCAG 0: 1
1: 0
2: 12
3: 102
4: 662
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757017_1033757027 -4 Left 1033757017 7:144403932-144403954 CCCCAGCCAGGAGCCCAGGCCCA 0: 1
1: 1
2: 8
3: 97
4: 700
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data
1033757010_1033757027 12 Left 1033757010 7:144403916-144403938 CCGCCTGCTCCGCTCCCCCCAGC 0: 1
1: 0
2: 11
3: 132
4: 1604
Right 1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033757027 Original CRISPR CCCAGGTGCGGGTCTCCTTC AGG Intronic