ID: 1033757088

View in Genome Browser
Species Human (GRCh38)
Location 7:144404146-144404168
Sequence TCTAGAGCCACTCCTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033757081_1033757088 6 Left 1033757081 7:144404117-144404139 CCCTTCCCTGTGGACTGTGGAAG 0: 1
1: 0
2: 1
3: 20
4: 269
Right 1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG No data
1033757082_1033757088 5 Left 1033757082 7:144404118-144404140 CCTTCCCTGTGGACTGTGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 249
Right 1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG No data
1033757085_1033757088 0 Left 1033757085 7:144404123-144404145 CCTGTGGACTGTGGAAGGCGATT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG No data
1033757078_1033757088 24 Left 1033757078 7:144404099-144404121 CCTGGATCGTGGCTAAAGCCCTT 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG No data
1033757084_1033757088 1 Left 1033757084 7:144404122-144404144 CCCTGTGGACTGTGGAAGGCGAT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033757088 Original CRISPR TCTAGAGCCACTCCTCAAAG GGG Intronic
No off target data available for this crispr