ID: 1033759010

View in Genome Browser
Species Human (GRCh38)
Location 7:144420826-144420848
Sequence CTTCTGAAGTCCAGGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033759010_1033759017 18 Left 1033759010 7:144420826-144420848 CCAGAGTGCCTGGACTTCAGAAG No data
Right 1033759017 7:144420867-144420889 AGTGCCTGACCAAACATATGAGG No data
1033759010_1033759013 -8 Left 1033759010 7:144420826-144420848 CCAGAGTGCCTGGACTTCAGAAG No data
Right 1033759013 7:144420841-144420863 TTCAGAAGTGGCCTAGATCTTGG No data
1033759010_1033759018 19 Left 1033759010 7:144420826-144420848 CCAGAGTGCCTGGACTTCAGAAG No data
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data
1033759010_1033759014 -7 Left 1033759010 7:144420826-144420848 CCAGAGTGCCTGGACTTCAGAAG No data
Right 1033759014 7:144420842-144420864 TCAGAAGTGGCCTAGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033759010 Original CRISPR CTTCTGAAGTCCAGGCACTC TGG (reversed) Intergenic
No off target data available for this crispr