ID: 1033759012

View in Genome Browser
Species Human (GRCh38)
Location 7:144420834-144420856
Sequence CTAGGCCACTTCTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033759012_1033759017 10 Left 1033759012 7:144420834-144420856 CCTGGACTTCAGAAGTGGCCTAG No data
Right 1033759017 7:144420867-144420889 AGTGCCTGACCAAACATATGAGG No data
1033759012_1033759018 11 Left 1033759012 7:144420834-144420856 CCTGGACTTCAGAAGTGGCCTAG No data
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data
1033759012_1033759021 29 Left 1033759012 7:144420834-144420856 CCTGGACTTCAGAAGTGGCCTAG No data
Right 1033759021 7:144420886-144420908 GAGGGCTATCCCTAAACCCTTGG 0: 77
1: 50
2: 51
3: 62
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033759012 Original CRISPR CTAGGCCACTTCTGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr