ID: 1033759015

View in Genome Browser
Species Human (GRCh38)
Location 7:144420852-144420874
Sequence CAGGCACTGGCCCAAGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 90, 1: 71, 2: 21, 3: 37, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033759015_1033759018 -7 Left 1033759015 7:144420852-144420874 CCTAGATCTTGGGCCAGTGCCTG 0: 90
1: 71
2: 21
3: 37
4: 362
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data
1033759015_1033759017 -8 Left 1033759015 7:144420852-144420874 CCTAGATCTTGGGCCAGTGCCTG 0: 90
1: 71
2: 21
3: 37
4: 362
Right 1033759017 7:144420867-144420889 AGTGCCTGACCAAACATATGAGG No data
1033759015_1033759021 11 Left 1033759015 7:144420852-144420874 CCTAGATCTTGGGCCAGTGCCTG 0: 90
1: 71
2: 21
3: 37
4: 362
Right 1033759021 7:144420886-144420908 GAGGGCTATCCCTAAACCCTTGG 0: 77
1: 50
2: 51
3: 62
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033759015 Original CRISPR CAGGCACTGGCCCAAGATCT AGG (reversed) Intergenic
900185737 1:1332401-1332423 CAGGCTCTCGCCCAAGGTGTGGG + Exonic
902572648 1:17356576-17356598 CAGGCACTGTGCCAAGTGCTAGG + Intronic
902818579 1:18929801-18929823 AAGGGACTTGCCCAAGATCACGG - Intronic
902935186 1:19759861-19759883 CAGGCATTGTCCCAAGCACTGGG - Intronic
903261135 1:22132398-22132420 CAGGGACTTGCCCAAGGTCATGG - Intronic
904039063 1:27574018-27574040 CAGGCCCAGGCCCAACATCCTGG + Intronic
904212740 1:28896785-28896807 CAGTCCCCAGCCCAAGATCTCGG - Intronic
905778273 1:40685082-40685104 GAGGTACTGGGCCAAGATGTGGG + Intergenic
906062882 1:42959701-42959723 CAGGAACTCGCCCAGGATCGCGG - Intergenic
906242732 1:44251965-44251987 CAGGCTCGGGCACAAGCTCTTGG - Intronic
907740701 1:57163087-57163109 CAAGCACTGGCCCAAGTCCCAGG + Intronic
907842597 1:58171710-58171732 CAGGCACTGGCCCAAGATCTAGG + Intronic
908300661 1:62758336-62758358 CAGGCACTGGCCCAAGATCTAGG + Intergenic
908357028 1:63331918-63331940 AAGGCAATGGCCAAATATCTGGG - Intergenic
908659533 1:66422085-66422107 CAGGCACTGGCCTAAGATCTAGG - Intergenic
908759809 1:67501184-67501206 CTGGCATTGGCTCAAGCTCTGGG + Intergenic
909764530 1:79338859-79338881 CAGGAACTGTCCCAGGCTCTGGG - Intergenic
910397201 1:86805079-86805101 GAGGCACTGGCCCAAGATCTAGG - Intergenic
910456299 1:87400701-87400723 CAGGCACTGGCCTAAATGCTGGG + Intergenic
910877616 1:91892005-91892027 CAGGCACTGGCTTCAGATCTGGG + Intronic
911042380 1:93600879-93600901 CAGGCACTGGGCCAGGCTCTGGG - Intronic
911129536 1:94374739-94374761 CAGGCACTGGCCCAAGATGTAGG - Intergenic
911751648 1:101502967-101502989 CAGGCACTGGCCCAAGATCTAGG + Intergenic
912021540 1:105113099-105113121 CAGGCACTGGCCCAAGATCTAGG + Intergenic
913296130 1:117322345-117322367 CAGGCACTGAGCTAGGATCTGGG + Intergenic
913529943 1:119726733-119726755 CAGCCACTTCCCCAAGAACTGGG - Intronic
915523977 1:156465011-156465033 CAGGCACTGGGCGAGGCTCTGGG + Exonic
916083916 1:161254452-161254474 CAGGCACTGGCCCAAGATCTAGG + Intergenic
916344579 1:163773557-163773579 CAAGCTCTGGGCCAAGCTCTGGG - Intergenic
916891024 1:169112567-169112589 CAGGCAGTAGCCCTTGATCTAGG - Intronic
916939781 1:169666089-169666111 CAGGCACTGGCCCAAGATCTAGG + Intronic
917086370 1:171308920-171308942 CAGGCACGGGCCCAAGATCTAGG + Intergenic
917280133 1:173371937-173371959 CAGGCACTGGCCCAAGATCTAGG + Intergenic
919206524 1:194426073-194426095 CAGGCACTGGCCCAAGATCTAGG + Intergenic
919543328 1:198879036-198879058 CAGGCACTGTTCTAAGATCTTGG + Intergenic
919558945 1:199094604-199094626 CAGGCACTGGCCCAAGATCTAGG + Intergenic
919736834 1:200957871-200957893 CTGGGACTGGCCCAGCATCTGGG - Intergenic
919848012 1:201653862-201653884 AAGGCACTGGCACAAAACCTTGG + Intronic
920195276 1:204222529-204222551 CAGGCCCTGGCCCAGGACCACGG + Exonic
920882396 1:209892697-209892719 CAGGCTCTGTTCCAAGAGCTGGG - Intergenic
921019945 1:211226266-211226288 CAGGTACTGGCCCAAGATCTAGG + Intergenic
921131549 1:212224180-212224202 CAGGCACTGGGCTAAGAACTGGG + Intergenic
921178585 1:212614069-212614091 CAGGCATTGGGCCAGGCTCTGGG + Intronic
921299014 1:213732502-213732524 CAGGCACTGGGCTAGGACCTGGG - Intergenic
922187315 1:223286974-223286996 CAGGCTCTGGCTCAAAATCCTGG - Intronic
922279174 1:224106558-224106580 CAGGCCCAGGACCCAGATCTTGG + Intergenic
922481040 1:225940262-225940284 CTGGCACTGGCTCTAGCTCTGGG + Intronic
923506333 1:234609404-234609426 CATGCCCTGGGCCATGATCTGGG - Exonic
924385046 1:243492260-243492282 AGGGCACTGGCTCAAGCTCTCGG + Intronic
1062792155 10:314568-314590 CAGGCACTGGCCACAGACCATGG - Intronic
1063321455 10:5056169-5056191 CAGGCACTGGCCCAAGATCTAGG - Intronic
1064067935 10:12199517-12199539 CAGGCACTGTTCCATGAGCTGGG - Intronic
1064603312 10:17014768-17014790 CAGGCACTGGCCCAAGATCTAGG - Intronic
1065082674 10:22142871-22142893 CAGGTACTGGCCCAAGATCTAGG + Intergenic
1066467972 10:35670241-35670263 CAGGCAGTGCCCTAAGATCAGGG - Intergenic
1066614326 10:37280572-37280594 GAGGCACTGGCACAAGATCTCGG - Intronic
1068500563 10:57836754-57836776 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1069137088 10:64780739-64780761 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1069232569 10:66029742-66029764 CAGGCACTGTTCCAAGCTCATGG - Intronic
1069747321 10:70724050-70724072 CAGGCACTGTGCCAAGGGCTTGG - Intronic
1069751945 10:70750451-70750473 CAAGCCCTGGCCCATGCTCTAGG - Intronic
1069824002 10:71244277-71244299 CAGGCATTGGCCCAGGCTGTAGG - Intronic
1070151436 10:73807719-73807741 CAGGCAGTGGCCCTGGTTCTAGG + Exonic
1070645078 10:78196203-78196225 CAGGCACTGTGCCAGGTTCTGGG - Intergenic
1071719196 10:88125911-88125933 CAGGCACTGTGCCAGGTTCTAGG + Intergenic
1072371409 10:94769299-94769321 CAGGTACTGGCCCAAGATCTAGG - Intronic
1072905494 10:99449500-99449522 CAGGCACTGTTCCAGGAACTGGG - Intergenic
1073281734 10:102359514-102359536 CAGGCAGTAGTCCAATATCTTGG - Intronic
1073422265 10:103434077-103434099 CAGGCACTGGGCCAAGCTTAGGG - Intronic
1073971006 10:109045343-109045365 CAGGCATTGGCCCAAGATCTAGG + Intergenic
1074095057 10:110304621-110304643 CAGGCGCTGGCCCTGGATCCCGG - Intronic
1074118752 10:110477578-110477600 CAGGCACTGGCTCAGGTACTAGG - Intergenic
1074857610 10:117485029-117485051 CAGGCCCTGGGCCAAGTGCTGGG + Intergenic
1075114933 10:119618258-119618280 CAGAAACTGCCCCAAAATCTTGG - Intergenic
1075146577 10:119887554-119887576 CAGGCACTTGCCCAAGATCTAGG + Intronic
1075734599 10:124656179-124656201 CAGGGCAAGGCCCAAGATCTGGG + Intronic
1075831396 10:125414582-125414604 CAGGCACTGGACCATGATGGGGG + Intergenic
1076032678 10:127172815-127172837 CAGGCACTGTGCCATGTTCTGGG + Intronic
1076751245 10:132544456-132544478 CTGTCTCTGACCCAAGATCTCGG + Intronic
1076833444 10:133008296-133008318 CCGGCACTGGGCCACCATCTGGG + Intergenic
1077077857 11:709338-709360 CAGGCACTGGCCTCAGACCGGGG + Exonic
1077505406 11:2927879-2927901 CAGGTACTGGCCCAGGACATTGG - Intergenic
1078117001 11:8463489-8463511 CAGGTACCGGTCCAAGACCTGGG + Intronic
1079525916 11:21387420-21387442 CAGGGACTGTTCCAAGAGCTGGG - Intronic
1079730961 11:23937509-23937531 CAGGCCCTAGCCCAAGATCTAGG - Intergenic
1079811412 11:25003239-25003261 CAGGCACTGGCCCAAGATCTAGG - Intronic
1080457963 11:32432330-32432352 CAGGGCCTGGCCCAAGACTTGGG - Intronic
1081421688 11:42879038-42879060 CAGGCCCTAGCCCAAGATCTAGG + Intergenic
1081715912 11:45250348-45250370 CAGGCGCTGTGCCAAGAGCTGGG - Intronic
1083687612 11:64386085-64386107 CAGGCATTGGCCCTAGAGCCTGG + Intergenic
1084211268 11:67624089-67624111 CAGGCCCTAGCCAAAGATCTAGG + Intergenic
1084568249 11:69943798-69943820 CGGGCACTGGCCCCAGAACAAGG + Intergenic
1084882355 11:72180759-72180781 CAGGCACTGACCCAGACTCTGGG - Intergenic
1086133196 11:83421564-83421586 CAGCCACTAAGCCAAGATCTGGG - Intergenic
1086317649 11:85610563-85610585 CAGGCACTGGCCCAAGATCTAGG + Intronic
1087075241 11:94122245-94122267 CAGGCATTGGCCCAAGATCTAGG + Intergenic
1087630343 11:100643012-100643034 TAGGCACAGCCCCAAGCTCTGGG - Intergenic
1087683084 11:101236597-101236619 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1088047102 11:105467053-105467075 CAGGTACAGAGCCAAGATCTGGG - Intergenic
1088492797 11:110403453-110403475 CAGGCACTGGCTCAAGATCTAGG + Intergenic
1088525038 11:110743607-110743629 CTGTCACTGGCCTAACATCTAGG + Intergenic
1088821851 11:113463383-113463405 CAGGGACGGGTCCCAGATCTGGG + Intronic
1089121291 11:116137505-116137527 CAGGCACAGGCACAGGTTCTAGG - Intergenic
1089347218 11:117798013-117798035 CAGGCACTGGCTCAGGCACTGGG + Intronic
1089636010 11:119812175-119812197 CAGGCACTGGGCTAAGCCCTGGG + Intergenic
1091573645 12:1713053-1713075 CAGGCACTGGTCCAAGATCTAGG - Intronic
1091948570 12:4571902-4571924 GAGGCACTGACCTAAGTTCTGGG - Intronic
1092024921 12:5232364-5232386 CAGGCACTGCACCAAGCACTGGG - Intergenic
1092472576 12:8792339-8792361 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1092844036 12:12567581-12567603 CAGGCACTGCACCTAGCTCTGGG + Intergenic
1093345507 12:18035349-18035371 CAGGCACGGGCCCAAGATCTAGG + Intergenic
1094158161 12:27359709-27359731 CAGGCACTGTGCCAGGATTTAGG + Intronic
1095585004 12:43839739-43839761 CAGGCACTGGCCTATGTGCTAGG - Intronic
1095691755 12:45097463-45097485 CAGACACTGTCCTAAGAGCTTGG + Intergenic
1096072008 12:48780623-48780645 CAGGCACTGGGCCTGGCTCTGGG + Intronic
1097103112 12:56603500-56603522 GAGGTACTGGCCCAAGATCAAGG - Exonic
1097200861 12:57277381-57277403 AAGGCACTTGCCCCAGGTCTGGG - Intronic
1099376501 12:81900500-81900522 CAGGCATTGGCCCAAGATCTAGG + Intergenic
1100210054 12:92390668-92390690 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1100529964 12:95453941-95453963 CAGGCACTGGCCCAAGATTTAGG - Intergenic
1101005470 12:100397263-100397285 CAGTGACTTGCCCAAGATCATGG + Intronic
1101317962 12:103646747-103646769 CAGGCACTGCCCTAAGTGCTAGG + Intronic
1101411065 12:104468713-104468735 CAGGCACTTGCCCAAGTCATGGG - Intronic
1101779769 12:107824774-107824796 CAGGTACTGGCCCAAGATCTAGG + Intergenic
1101800945 12:108021570-108021592 GAGGCACTGGCCCAACACTTGGG + Intergenic
1102302319 12:111779833-111779855 CAGGCACTGGGCGATGGTCTTGG - Intronic
1102432946 12:112897770-112897792 CAGCCATTGGCCCAAGCCCTGGG - Exonic
1102633107 12:114299404-114299426 CAGGCCCTGGGCCAAGCACTGGG + Intergenic
1102993156 12:117329234-117329256 CAGGCACTGTCCTAAGCTCTAGG - Intronic
1103385560 12:120529504-120529526 CAGGAATTGGCCCGTGATCTTGG - Intronic
1104306424 12:127614304-127614326 CAGGCACTGGTCCAAGATCTAGG + Intergenic
1104767358 12:131338909-131338931 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1104987331 12:132604260-132604282 CAGGCACTGGGCCAGGATCCCGG + Exonic
1105070786 12:133233208-133233230 CAGGCTCAGGCCCCGGATCTGGG + Intronic
1105969500 13:25415260-25415282 CAAGCATTGCCCCAAGATTTGGG - Intronic
1106033862 13:26026403-26026425 CAGGCAAGGGGCCAACATCTGGG - Intergenic
1106162963 13:27216783-27216805 CAGGCCCTGGCCCAAGATCTTGG + Intergenic
1106781526 13:33063116-33063138 CAGGAGCTGCCCCAAGTTCTTGG + Intronic
1106812036 13:33368221-33368243 CAGGCACTGGGCCAGGATCGAGG - Intergenic
1108848865 13:54704309-54704331 CAGGCACTGACTCAAGATCTAGG + Intergenic
1109424704 13:62154324-62154346 GAGGCACTGGCCCAAGATCTAGG + Intergenic
1110645888 13:77883680-77883702 CAGGCACTGTTCCAGGTTCTAGG + Intergenic
1112519392 13:100082341-100082363 CAGGCCCTAGCCCAAGATCTAGG + Intergenic
1112538644 13:100284859-100284881 CAGGCCCTAGCCCAAGATCTAGG + Intronic
1112643677 13:101305843-101305865 CAGGCACTGGCCCAGGCCCTAGG - Intronic
1112694064 13:101927822-101927844 CAGGCACTGCTCCAGGCTCTGGG - Intronic
1112813377 13:103245190-103245212 CAGGCATTGGCTCAACTTCTGGG + Intergenic
1113130494 13:107031369-107031391 CAGGCACTGTCCTAAGTGCTTGG - Intergenic
1113203669 13:107893245-107893267 CAGGCAGTGGCCCAAGATCTAGG - Intergenic
1113351646 13:109535362-109535384 CAGGCACTGTTCTAAGTTCTTGG + Intergenic
1113521890 13:110947313-110947335 CAGGCACTGTCCTAGGCTCTGGG - Intergenic
1113551238 13:111194718-111194740 CAGGCATTGGCCCAAGATCTAGG - Intronic
1113706003 13:112433386-112433408 CAGGCACTGTCCTAGGCTCTGGG + Intronic
1115285199 14:31707874-31707896 CAGGCACTGGCCCAAGATCTAGG - Intronic
1116967539 14:51030161-51030183 CAACTACTGGCCTAAGATCTTGG + Intronic
1117070735 14:52053717-52053739 AAGGCACTGGCCCTCCATCTGGG + Exonic
1117098236 14:52318716-52318738 CAGGCATTGTCCCAAGGTTTGGG + Intronic
1117553676 14:56862408-56862430 CAGGCACAGGGCCAGGATCTAGG + Intergenic
1119319726 14:73722818-73722840 CACGCACTGGGCCACGGTCTTGG + Exonic
1119743281 14:77027708-77027730 CATGCCCTGGGCCATGATCTGGG - Exonic
1121384001 14:93500373-93500395 CAGGCACTGTCCTAAGTACTGGG + Intronic
1121579466 14:95016651-95016673 CAGGCACTCTCTTAAGATCTGGG + Intergenic
1121956544 14:98218561-98218583 CAGGCACTGACCAGACATCTTGG - Intergenic
1122271632 14:100570935-100570957 CACCCACTGGCCCAAGACCCAGG - Intronic
1126071837 15:44872351-44872373 CAGGCACTGGCCCAAGATGTAGG - Intergenic
1126086423 15:45014632-45014654 CAGGTACTGACCCAAGATCTAGG + Intergenic
1128068212 15:64776910-64776932 CAGGCACTTGTCCACGGTCTGGG - Intergenic
1128092479 15:64928299-64928321 AAGGCACTGGGCCAGGAACTAGG + Intronic
1129021341 15:72521898-72521920 CTGGCACTTGCCCAAGTGCTGGG - Intronic
1129110401 15:73333861-73333883 CAGGAACTTGCCCAAGATCACGG + Intronic
1130215875 15:81968962-81968984 CAGCCACTTGCCCAACAGCTTGG + Intergenic
1131474388 15:92724318-92724340 GAGGCACTGGCAGAAGATCAAGG - Intronic
1132039404 15:98512319-98512341 GAGGCACTGGCCTATGGTCTGGG - Intronic
1133267465 16:4593687-4593709 CAGGCACTGTGCCAAGCGCTGGG + Intronic
1134233075 16:12444483-12444505 CAAGTACTGGCCCCAGATCCTGG + Intronic
1134401826 16:13917552-13917574 CAGGCACTGCTCTAAGCTCTGGG - Intergenic
1134846495 16:17445304-17445326 CAGGCACTGGGCTAGGTTCTTGG - Intronic
1134862176 16:17570026-17570048 CAGGCACTGTTCTAAGAACTTGG + Intergenic
1135138483 16:19902216-19902238 CAGGCACTGTCCCAGGCCCTTGG + Intergenic
1135339409 16:21633409-21633431 CAGACACTGGCCCAAGATCTAGG - Intronic
1137369249 16:47889448-47889470 CAGGCACTGTTCCAGGAACTGGG - Intergenic
1137494000 16:48955227-48955249 CAGACACTGTCCCAAGATTCTGG + Intergenic
1137866228 16:51899391-51899413 CAGGCACTGTGCCAGGCTCTGGG - Intergenic
1138046232 16:53728482-53728504 CAGGCCCTGGTCTAAGTTCTAGG + Intronic
1138250041 16:55495027-55495049 TAGGCACTGGGCCAAATTCTGGG + Intronic
1138494407 16:57398863-57398885 CAGGCACTGGCCCAAGATCTCGG - Intergenic
1139101609 16:63773938-63773960 CAGGCCCTCGGCTAAGATCTTGG + Intergenic
1139419902 16:66843953-66843975 CAGGCGCTGGACCAAGCTTTGGG - Intronic
1139487442 16:67265927-67265949 CAAGCACTGGCCTAAGAGGTGGG - Intronic
1139826528 16:69761799-69761821 CAGGCACTGTTCTAAGATCCAGG - Intergenic
1140918810 16:79518245-79518267 CATGCACTGGCACAGGTTCTAGG - Intergenic
1141067195 16:80923722-80923744 CAGGCACTGTCCCAGGATCTGGG + Intergenic
1141475615 16:84271182-84271204 CAGTAACTGGCCCAAGTGCTTGG - Intergenic
1141677951 16:85527461-85527483 CTGGCTCTGGCCCCAGCTCTGGG - Intergenic
1141878284 16:86841388-86841410 CAGGCTCTGGCCCGAGCACTGGG + Intergenic
1141926460 16:87173543-87173565 CAGGCACTGTGCCCATATCTGGG + Intronic
1142055892 16:87995793-87995815 CAAGCTCTGGGTCAAGATCTTGG + Intronic
1142122097 16:88391564-88391586 CAGGCACAGGCCCAATGCCTCGG + Intergenic
1142147547 16:88498915-88498937 CAAGCACTGGCCCCAGGCCTGGG + Intronic
1142247365 16:88976206-88976228 AGGGCACTGGCCCAAGACCCCGG - Intronic
1142323332 16:89399202-89399224 CAGCCACTGGCCCCTGAACTCGG - Intronic
1144750962 17:17647731-17647753 CAGGCACTGACCTAAGCCCTGGG - Intergenic
1145804363 17:27715849-27715871 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1146629967 17:34462802-34462824 CAAGCACTGCCCCAATCTCTTGG - Intergenic
1147332098 17:39705300-39705322 CAGGCCCTGGCCCAAGCCCAGGG - Intronic
1147597365 17:41725582-41725604 CAGGCACTGGCTTAGGAGCTGGG - Intronic
1148884816 17:50764740-50764762 CAGGCACTGGGCTAAGCCCTGGG + Intergenic
1149010684 17:51853505-51853527 GAGGCACTTGCCCATGATGTTGG + Intronic
1149074149 17:52577249-52577271 CAGTCACTGGCCCAAGATCTAGG + Intergenic
1149209946 17:54290558-54290580 CAGGCACTGGCTCAAGATCTAGG + Intergenic
1149213495 17:54329216-54329238 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1150139221 17:62714532-62714554 CAGGCACTGGGCCAGGCACTAGG - Intronic
1150472093 17:65446179-65446201 CAGGCTCTGGGCCAAGCCCTGGG + Intergenic
1151568283 17:74912422-74912444 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1152985867 18:320440-320462 CAGGCATTGGTCCAAGTGCTAGG - Intronic
1155184164 18:23372842-23372864 CAGGCACTGAGCCAGGCTCTGGG - Intronic
1155475870 18:26235588-26235610 CAGCCACTGGCCCAAGATCTAGG - Intronic
1156943453 18:42797620-42797642 CAGGAAATGGTCCTAGATCTTGG - Intronic
1157857309 18:51114794-51114816 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1160437293 18:78861583-78861605 CAGGGACTGTCCTAAGATCTAGG - Intergenic
1160745290 19:708680-708702 CCGGCTCTGGCCCAGGAGCTGGG + Intergenic
1160888841 19:1366193-1366215 CAGGCGCTGACCCCAGCTCTGGG - Intronic
1160918514 19:1508891-1508913 CAGACACTGTTCCAAGCTCTAGG + Intronic
1161597965 19:5161868-5161890 CAGGTACTGGCCCAAGATTTAGG - Intronic
1162108161 19:8383528-8383550 CAGGCACTGGCTCAAGATCTAGG + Intronic
1162237187 19:9318645-9318667 CAGGCATTGGCCCAAGATCTAGG - Intergenic
1162305451 19:9870519-9870541 CAGGCACTGAACCAGGATGTAGG + Intronic
1162441470 19:10695044-10695066 AAAGCACTGGCCCAAGACCTGGG - Intergenic
1162711253 19:12596698-12596720 CAGGCACTGACCCACTGTCTGGG - Intronic
1162738361 19:12759219-12759241 CAGCCACTGTCCCAGGATCATGG + Intergenic
1163622611 19:18369802-18369824 AAGGCACTGGCAAAAGTTCTAGG - Exonic
1164258806 19:23551710-23551732 CAGCCACTAAGCCAAGATCTGGG - Intronic
1164880491 19:31728674-31728696 CCTGCACTGACCCAAGATCGGGG - Intergenic
1165046484 19:33108717-33108739 CAGGACCTGGCCCAGGAGCTTGG - Intronic
1165088003 19:33364658-33364680 CAGGCCCTGTCCCAAGTTCTGGG - Intergenic
1165847338 19:38826777-38826799 CAGGCACTGGCCCAAGATCTAGG + Intronic
1165897956 19:39154818-39154840 GAGGCAGTGGCCTGAGATCTGGG + Intronic
1167123376 19:47532350-47532372 CAGGCTGTGGCCCAAGAGCAGGG - Intronic
1168469312 19:56627895-56627917 AAGGCTCTGGGCCCAGATCTTGG + Intergenic
1168644414 19:58050964-58050986 GAGCCACTGGCCACAGATCTGGG - Intronic
925949638 2:8898645-8898667 CAGGCACTGGCCCAAGATCTAGG - Intronic
926425849 2:12737977-12737999 AAGGCACTGGGCTAAGAGCTAGG - Intronic
926620668 2:15043962-15043984 CAGGTACTGGCCCATGTGCTTGG - Intergenic
926813547 2:16778218-16778240 CAGGGACTTGCCCAAGGTCACGG + Intergenic
926986226 2:18627174-18627196 CAAGCTATGGCCCTAGATCTCGG + Intergenic
927212885 2:20649562-20649584 CGGGTACTGGCCCTAGTTCTAGG - Intronic
927271628 2:21216351-21216373 CAGGCACTGTGCTAAGGTCTGGG + Intergenic
927857901 2:26538553-26538575 CTGGAACTGGCCCAAGATGTGGG + Intronic
928617363 2:33053922-33053944 CAGGCACTGGCCCAAGATCTAGG - Intronic
929929114 2:46238504-46238526 CAAGCACTTGCCCAAGGTCATGG + Intergenic
930038787 2:47104653-47104675 CAGGCACTGGCCCAAGATCTAGG + Intronic
930876657 2:56226335-56226357 CAGGCACTGTACTAAGAACTGGG - Intronic
931770514 2:65493144-65493166 CAGGCACTGAGGCAAGCTCTTGG + Intergenic
934564503 2:95330805-95330827 CAGGCAATGTCCCAGGCTCTGGG + Intronic
934707871 2:96497389-96497411 CAGGCAGTGCCCCAAAATCAAGG + Intergenic
934867377 2:97825161-97825183 CAGGCACTGGCCCATGATCTAGG + Intronic
935341557 2:102063963-102063985 CAGGAACTGGGTCAAGAACTGGG - Intergenic
935530103 2:104221711-104221733 CAGGCCCTGTCCCAAGTGCTGGG - Intergenic
935535390 2:104287125-104287147 GAGGCACTGGCAGAAGATCAGGG - Intergenic
936528237 2:113256984-113257006 CAGGCACTGTTCCAGGTTCTGGG + Intronic
936802309 2:116284032-116284054 CAGGCACTGGCCCAAGATCTAGG + Intergenic
938805941 2:134807353-134807375 CAGGCCCTGGCCCAAGATCTAGG - Intergenic
938823879 2:134985245-134985267 CTGGCAGTGGGCCAAGAACTAGG - Intronic
939852105 2:147315437-147315459 CAGGCACAGGCCCAAGATCTAGG + Intergenic
943134003 2:183889499-183889521 CAGGCACTGGCCCAAGATCTAGG + Intergenic
944318319 2:198307126-198307148 CAGGCACTGGGCCATGTGCTTGG + Intronic
945196531 2:207242350-207242372 CGGTTACTGGACCAAGATCTAGG - Intergenic
946207117 2:218117878-218117900 CAGGCACTGGCCCAAGATCTAGG - Intergenic
947373875 2:229475580-229475602 CAGGCACTGTGCCAGGAGCTAGG - Intronic
947417224 2:229909200-229909222 CAGGCCCTAGGCCAAGATTTAGG - Intronic
947736280 2:232457098-232457120 CAGGACCAGGCCCAAGATCTCGG + Intronic
948579149 2:238972199-238972221 GAGGCACGGGCACAGGATCTGGG - Intergenic
948987662 2:241535094-241535116 CAGGCACAGGCCTCAGATTTGGG - Intergenic
1169625843 20:7567958-7567980 CAGGCACTGTGCCAAGAACTGGG + Intergenic
1170206973 20:13809009-13809031 CAGGCACTGGGCAAAGCACTAGG + Intronic
1170640148 20:18144870-18144892 CAGGCACTGGGCTAGGAACTGGG - Intronic
1170692131 20:18625457-18625479 CTGGCACTGGCCCAGCCTCTGGG + Intronic
1171982714 20:31638745-31638767 CAGACCCTGGCCCAAGACTTAGG + Intronic
1172114165 20:32563807-32563829 CAGGCAATGTCCCAGGCTCTAGG - Intronic
1172539462 20:35699584-35699606 CAGGCGCTGGCCCAAGAGTCGGG - Intronic
1172701516 20:36856214-36856236 CAGGCACTGTTCTAAGAGCTGGG + Intronic
1173299953 20:41793748-41793770 CAGGCAAGGGCACATGATCTTGG + Intergenic
1173576904 20:44118112-44118134 CAGGCACTGTACCAGGCTCTGGG - Intronic
1173747407 20:45448477-45448499 CAGGCACTGTCCTAAGTGCTGGG - Intergenic
1174268247 20:49347617-49347639 CAGGCAATGGCCTAAGTGCTAGG - Intergenic
1174419049 20:50387546-50387568 CAGGCACTGGGCAAGGCTCTGGG - Intergenic
1174434196 20:50493780-50493802 CAGGCACTTGCCTAAGCTCTTGG + Intergenic
1174513471 20:51073564-51073586 CAGGCACTGTTCCAGGCTCTAGG + Intergenic
1174577140 20:51544529-51544551 CTGGCACTGCCACAAGATGTTGG + Intronic
1175171239 20:57082767-57082789 CAGGCACGGGCCAGGGATCTGGG + Intergenic
1175362529 20:58424679-58424701 CAGGCACTGGCCAAATAACAAGG - Intronic
1176134778 20:63517710-63517732 GAGGCACTGGCCAGAGAGCTGGG + Intergenic
1176413810 21:6463451-6463473 CAGGCACTGGCCTAGGCGCTGGG + Intergenic
1177135306 21:17300830-17300852 CAGGCACTGGCCCAAAATCTAGG + Intergenic
1177168331 21:17628149-17628171 TAGGCACTGTTCCAAGTTCTGGG + Intergenic
1178307913 21:31505956-31505978 AGTGCAGTGGCCCAAGATCTTGG - Intronic
1178694673 21:34782505-34782527 CAGGCACTGTTCAAAGAGCTTGG + Intergenic
1179689308 21:43071773-43071795 CAGGCACTGGCCTAGGCGCTGGG + Intronic
1180825562 22:18858598-18858620 CACGCACTGGCGCACGATGTAGG + Intronic
1181212030 22:21294544-21294566 CATGCACTGGCGCACGATGTAGG + Intergenic
1181500217 22:23311717-23311739 CACGCACTGGCGCACGATGTAGG - Exonic
1181651939 22:24263720-24263742 CACGCACTGGCGCACGATGTAGG + Intergenic
1181705439 22:24647023-24647045 CACGCACTGGCGCATGATGTAGG - Intergenic
1181734303 22:24869745-24869767 CAGGCACTGGCACATGAGATGGG + Intronic
1181923633 22:26340492-26340514 AAGGTACTGCCCCAAGATGTGGG - Exonic
1181969880 22:26681848-26681870 CAGGGTCTGGCCCCAGATCCAGG - Intergenic
1182830652 22:33302242-33302264 CAGGCACTGGCACAGGCGCTGGG + Intronic
1184652470 22:45925497-45925519 CAGGCTCTGGCCCATGACCTTGG - Intronic
1203214925 22_KI270731v1_random:888-910 CACGCACTGGCGCACGATGTAGG - Intergenic
1203275714 22_KI270734v1_random:84505-84527 CACGCACTGGCGCACGATGTAGG + Intergenic
950073458 3:10170666-10170688 CAGGCACTGTCCCAGGCTCTGGG - Intronic
950532912 3:13563412-13563434 CAGTCACTGGCCAAAGACCATGG - Intronic
951020733 3:17778503-17778525 CAGGCACTGGCCCAAGATCGAGG + Intronic
952453283 3:33450704-33450726 CAGGCACTGGCCCAAGATCTAGG + Intergenic
952890881 3:38039715-38039737 CAGGCGCTGTTCCAGGATCTGGG + Intronic
952940706 3:38442380-38442402 CAGGCACTGGCCCAAGTTCTAGG - Intergenic
953070601 3:39515712-39515734 AAGGCACCTGGCCAAGATCTTGG - Exonic
953155282 3:40365559-40365581 CAGGCACTGTTCTAAGAACTTGG + Intergenic
953461948 3:43088583-43088605 CAGTAACTGGCCCAAGAAGTAGG - Intronic
953622691 3:44546862-44546884 CAGGTACTGGCCCGAGATCTAGG - Intergenic
953933259 3:47017713-47017735 CAGGCACTGGACGATGAACTGGG + Exonic
953949477 3:47177601-47177623 CAGCTAGTGGCCCAAGCTCTGGG + Intergenic
954212096 3:49103667-49103689 CAGGCACCGGCCCCAGCTCCTGG - Exonic
954294464 3:49666395-49666417 CAGGCACTCTTCCAGGATCTGGG + Intronic
954587234 3:51746388-51746410 CAAACACTGGCCCAAGATCTAGG + Intergenic
954932747 3:54298141-54298163 CAGGCAGTGGCCCTTGATCTGGG + Intronic
955002742 3:54942303-54942325 CAGACTCTGGCCCAAGAAGTAGG + Intronic
955445250 3:59002916-59002938 AAGTCACTTGCCCAAGGTCTTGG + Intronic
955755556 3:62221949-62221971 CAGGCACTGTGCCAAGCACTTGG + Intronic
955780296 3:62477503-62477525 CAGGCACAGGGCTAAGTTCTTGG - Intronic
955888454 3:63625252-63625274 CAGGCACTGTTCCAAGTGCTGGG - Intergenic
955889134 3:63631953-63631975 CAGGCACTGTGCCAAGGCCTTGG - Intergenic
956255421 3:67278404-67278426 CAGGCACTGGCACTAGACATTGG + Intergenic
958548988 3:95591423-95591445 CAGGCACTGGCCCAAAATCTAGG - Intergenic
960691037 3:120347185-120347207 CAGGCACTGTCCCAAGTATTGGG - Intronic
960951009 3:122998390-122998412 CAGTGACTGGCCCAAGGTCAAGG - Intronic
961207465 3:125096450-125096472 CAGACACTGTCCCAAGTGCTGGG - Intronic
961264032 3:125625885-125625907 CAGGCACTGTGCTAAGAGCTGGG - Intergenic
961436772 3:126924564-126924586 CAGGCACTGTCCCCAGAGCTGGG + Intronic
961672135 3:128541165-128541187 TAGGCCCTGGACCAAGCTCTGGG - Intergenic
961950443 3:130744220-130744242 CAGGCACTGTCCTAAGTGCTAGG - Intronic
962118305 3:132535254-132535276 CAGTCACATGCCCAAGATTTGGG + Intronic
962923998 3:139975205-139975227 CAGGCACAGCCTCAAGAACTGGG + Intronic
963301515 3:143602318-143602340 CTGGCTCAGGCCCAAGAACTAGG + Intronic
963696993 3:148574885-148574907 CAGGTACTGGCCCAAGATCTAGG + Intergenic
963992045 3:151666877-151666899 CAGGTACTGGCCCAAGATCTAGG - Intergenic
964064749 3:152563888-152563910 CAGGCACTGGCCCAAGATCTAGG + Intergenic
964065152 3:152568949-152568971 CAGGCACGTGCCACAGATCTAGG - Intergenic
964916730 3:161849620-161849642 CAGGCATTGGCCCAAGACCTAGG - Intergenic
965062977 3:163805634-163805656 CAGGCACTGGCTCAAGATCTAGG + Intergenic
965139438 3:164815549-164815571 CAGGCACTGGCCCAAGATCTAGG + Intergenic
965715743 3:171600899-171600921 CAAGCACTGGTCCAGGCTCTGGG + Exonic
966198058 3:177333503-177333525 CAGGCACTTGGCTAGGATCTGGG - Intergenic
966625998 3:182017692-182017714 CAGTGACTGGCCCCAGATTTGGG - Intergenic
966992286 3:185245333-185245355 CAGCCACTAGCCAAAGAACTTGG + Intronic
967086485 3:186099385-186099407 CTGGCACTTGTCCAAGAGCTGGG + Intronic
967583906 3:191189825-191189847 CAGGCACTGGCCCAAGATCTAGG + Intergenic
967953466 3:194858877-194858899 CCGGCACTGTCCCAAGCACTTGG + Intergenic
968397301 4:253579-253601 CCTGCACTGGCCAAAGATCTTGG - Intergenic
968912523 4:3483404-3483426 GAGGCCATGGCCCAAGACCTTGG + Intronic
969367416 4:6705405-6705427 CAGGCACTGGTCTAAGTGCTAGG + Intergenic
969414511 4:7049899-7049921 CAGACACTGGGCCAACAACTAGG - Intronic
969669431 4:8581646-8581668 CATGCACTGGGCCAATACCTGGG - Exonic
970607541 4:17694700-17694722 CAGGCACTGTCCTCAGAGCTGGG + Intronic
971280953 4:25242317-25242339 CAGGCACTGGCCCAAGGTCTAGG - Intronic
972133054 4:35861101-35861123 CAGATACCGGCCCAAGATCCAGG - Intergenic
972686728 4:41360074-41360096 CAGGCACTGGGCCAGGCGCTGGG - Intronic
972833444 4:42840414-42840436 CAGGCACTGTCCTAGGAACTAGG - Intergenic
973046089 4:45535499-45535521 CAGGCACTGGCCCAAGATCTAGG + Intergenic
973653634 4:53022866-53022888 CAGGCACTGTGCCAAGCACTAGG - Intronic
974034272 4:56803768-56803790 CAGGCACTGTGCCAAGTGCTGGG + Intergenic
974174748 4:58308419-58308441 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974187562 4:58462155-58462177 CAGGTACTAGCCCAAGATCTAGG + Intergenic
974526791 4:63056913-63056935 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974537363 4:63188700-63188722 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974838618 4:67278238-67278260 CAGGCACTGGCCCAAGATCTAGG - Intergenic
975316207 4:72956227-72956249 CAGGCACTGGGCTAAACTCTGGG - Intergenic
975595582 4:76046118-76046140 CAGGCACTGGCCCAGGATCTAGG - Intronic
976549991 4:86382550-86382572 CAGGCACTGGGCTAGCATCTAGG - Intronic
977171828 4:93771908-93771930 CAGGCACTGTGCTAAGTTCTGGG - Intronic
977834697 4:101634216-101634238 CAGGCACTGACCCAAGATCTAGG - Intronic
977884324 4:102239367-102239389 CAGGCACTGGCCCAAGATCTAGG + Intergenic
980290664 4:130845160-130845182 CAGGCACTGGCTCAAGATCTAGG - Intergenic
982701359 4:158662049-158662071 CAGGCACTGGCCCAAGATGTAGG + Intergenic
983834705 4:172373123-172373145 CAGGCACTGGCCCAAGATCTAGG - Intronic
987545006 5:19303277-19303299 CAGGCACTGGCCCAAGATCTAGG - Intergenic
987697182 5:21347277-21347299 CAGCCACTGGCCCAAAATAAGGG - Intergenic
987818100 5:22930180-22930202 CAGGCACTGGCCCAAGATCTAGG + Intergenic
987930123 5:24391225-24391247 CAGGCACTAGCCCAAGAACTAGG + Intergenic
988358023 5:30201674-30201696 CAGGCACTAGCCCAAGATCTAGG + Intergenic
988591772 5:32555793-32555815 CAGGCACTGGCCCAAGATCTAGG - Intronic
988755052 5:34239414-34239436 CAGCCACTGGCCCAAAATAAGGG + Intergenic
989101923 5:37831336-37831358 CAGGCACTGTCCTAAGTGCTAGG - Intronic
989496413 5:42114928-42114950 CAGGCACTGGCCCAGGATCTAGG + Intergenic
989957574 5:50374404-50374426 CAGGCACAGGCCCAAGATCTAGG + Intergenic
990401324 5:55440303-55440325 CAGTCACAGGCCCATGCTCTGGG + Intronic
991743269 5:69705100-69705122 CAGCCACTGGCCCAAAATAAGGG + Intergenic
991754427 5:69850103-69850125 CAGCCACTGGCCCAAAATAAGGG - Intergenic
991794842 5:70284836-70284858 CAGCCACTGGCCCAAAATAAGGG + Intergenic
991804046 5:70406854-70406876 CAGCCACTGGCCCAAAATAAGGG - Intergenic
991822656 5:70580411-70580433 CAGCCACTGGCCCAAAATAAGGG + Intergenic
991833755 5:70725251-70725273 CAGCCACTGGCCCAAAATAAGGG - Intergenic
991887219 5:71284374-71284396 CAGCCACTGGCCCAAAATAAGGG + Intergenic
992049604 5:72930378-72930400 CAGGCACTGGCCAAAGATCTAGG + Intergenic
992455433 5:76911567-76911589 CAGGCACTGGTCCAAGATCTAGG + Intronic
992480262 5:77144181-77144203 CAGGCACTGGGTCCAGGTCTTGG + Intergenic
994231504 5:97314206-97314228 CAGGCACTGGCCCAAGATCTAGG - Intergenic
994454250 5:99984693-99984715 CAGGCACTGGCCCAAGATCTAGG + Intergenic
995049238 5:107683713-107683735 CAGGCACTGTTCCAGGAGCTAGG + Intergenic
995583184 5:113621737-113621759 CAGGTGCTGGCCCAAGATCTAGG - Intergenic
995706662 5:114994453-114994475 CAGGCATGGGTGCAAGATCTAGG + Intergenic
996592961 5:125168678-125168700 CTGCTCCTGGCCCAAGATCTGGG - Intergenic
996680442 5:126224238-126224260 CAGACACTGGCCCAAGATCTAGG + Intergenic
996839326 5:127829110-127829132 CACTCTCTGGCCCAAGCTCTTGG - Intergenic
998111689 5:139507392-139507414 CAGGCACTGGCCCAAGATCTAGG + Intergenic
998891667 5:146752729-146752751 CAGGCACTGTGCCAGGCTCTGGG + Intronic
999593207 5:153171894-153171916 CAGGCACTGGCACAGGAACAGGG + Intergenic
1000085456 5:157884089-157884111 CAGGCACTGGCCCAATATCTAGG + Intergenic
1000085463 5:157884126-157884148 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1000246994 5:159456799-159456821 CAGGCATTGGGCCAAGAGTTTGG - Intergenic
1000755338 5:165152051-165152073 CAGTCACTGGCCTAAAATCTGGG + Intergenic
1001057735 5:168463303-168463325 CAGGCACTGCCTCCAGATGTTGG + Intronic
1001515266 5:172350900-172350922 CAGGCTTTGGCCCCAGAGCTGGG - Intronic
1002440017 5:179259392-179259414 CGGGCACTGGGCCAGGCTCTGGG - Intronic
1002704070 5:181148609-181148631 CAGGCACTGGTCCAGGAGCCAGG + Intergenic
1002895157 6:1374812-1374834 CAGGCACTGGTCTAAGTGCTGGG - Intergenic
1002913691 6:1511093-1511115 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1004531599 6:16459750-16459772 CAGGCACTGTCCCAAGATCTAGG + Intronic
1004812475 6:19275289-19275311 CAGGTACTAGCCCAAGATCTAGG + Intergenic
1005553676 6:26951125-26951147 CAGCCACTGGCCCAAAATAAGGG + Intergenic
1006471881 6:34234245-34234267 CAGGAACTGGGCCAAATTCTTGG - Intergenic
1007030262 6:38620471-38620493 CAGATATTGGCCCAAGATCTAGG + Intronic
1009385720 6:63082731-63082753 CAGGTACTGGCCCAAGATTTAGG - Intergenic
1009471034 6:64028695-64028717 CAGGCACTGGCCCAAGATCTAGG + Intronic
1009873004 6:69472196-69472218 CAGGCACTGGCCCAAGATTTAGG + Intergenic
1010270045 6:73907873-73907895 CAGGTACTGGCCCAAGATCTAGG + Intergenic
1011374824 6:86677318-86677340 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1012441319 6:99264738-99264760 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1012624785 6:101392777-101392799 CGGCCACTGGTCCAAGTTCTCGG - Intergenic
1012959611 6:105608827-105608849 CAGACCCTGGCCGAAGTTCTGGG - Intergenic
1013907622 6:115237081-115237103 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1014202481 6:118621499-118621521 CAGGCACTGGCCCAAGACCTAGG + Intronic
1014603752 6:123447708-123447730 CAGGCAGTGACCCAAGATTGTGG + Intronic
1014885511 6:126776106-126776128 CAGGCCCTGTTCCAAGAGCTGGG + Intergenic
1015812863 6:137178782-137178804 CAGGCACTGTCTGAAGTTCTGGG + Intergenic
1016184240 6:141180223-141180245 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1016372872 6:143392743-143392765 CAGGCACTGTGCCAAGCTCCGGG + Intergenic
1017101179 6:150851112-150851134 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1017212324 6:151870740-151870762 CATGCACTGGGCCAAGGACTGGG - Intronic
1017492002 6:154952940-154952962 AAGGCACTGGCCCAGGTTCTAGG + Intronic
1018402657 6:163440770-163440792 CAGGCACTGGCCAAGGCCCTAGG - Intronic
1019389315 7:776787-776809 CAGGTACTGGCCCATGGCCTGGG - Intronic
1019426296 7:978605-978627 CAGGCACTGCTCCAGGCTCTGGG - Intergenic
1019524414 7:1474341-1474363 CAGGCACCTGCCCATGATCGCGG - Exonic
1019540278 7:1548166-1548188 AGGGCACGGGCCCAGGATCTGGG - Intronic
1021756502 7:23858033-23858055 CAGGCACTAGCCCAAGATCTAGG - Intergenic
1023745247 7:43317127-43317149 CAGCCACAGGCCCAAGAGCCTGG - Intronic
1024870565 7:53958640-53958662 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1025251967 7:57357455-57357477 CAGGCACTGGGCAAGGCTCTGGG + Intergenic
1026889401 7:73973339-73973361 CAGGCACAGGGCCAGGATCAAGG - Intergenic
1028495007 7:91452262-91452284 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1029177752 7:98676913-98676935 CTGGCACTGACCCATGATGTGGG - Intergenic
1029876838 7:103763366-103763388 CAGGTACTGTGCCAAGTTCTGGG + Intronic
1030107459 7:105999058-105999080 TGGCCACTGGCCCAAGCTCTGGG + Intronic
1031151758 7:118061645-118061667 CAGGCACTGAGCCACCATCTGGG + Intergenic
1031732001 7:125311894-125311916 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1032557355 7:132850674-132850696 CAGACACTGGGCCAAGAACTTGG + Intronic
1033759015 7:144420852-144420874 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1034312150 7:150098163-150098185 CAGTCGCTGGCCCAATACCTAGG - Intergenic
1034579747 7:152032198-152032220 CAGGCACTGGCCCAAGATCTAGG - Intronic
1034794706 7:154002495-154002517 CAGTCGCTGGCCCAATATCTAGG + Intronic
1035280217 7:157773639-157773661 GAGGCACTGGGCCAAAGTCTGGG - Intronic
1036002103 8:4617879-4617901 CAGGCATTGGTCCAGGTTCTGGG - Intronic
1036580785 8:10073649-10073671 CAGCCAATGGCTCAAGCTCTAGG - Intronic
1038156495 8:24996328-24996350 CAGTGACTGGCACAAGAACTGGG + Intergenic
1038186886 8:25283316-25283338 CAGACACTGGCCCAGGAATTGGG + Intronic
1038395051 8:27240455-27240477 CAGGCACTGGTCTAACAGCTTGG + Intronic
1038430564 8:27496321-27496343 CAGGCACTGGCCCAAGATCTAGG - Intronic
1038639014 8:29309040-29309062 CAGGCACTGGCCTGAGATCTAGG + Intergenic
1038661132 8:29498038-29498060 CAGGCACTGTACCAGCATCTGGG + Intergenic
1039164084 8:34657090-34657112 CAGGCACTATTCCAAGAGCTTGG + Intergenic
1039276218 8:35936059-35936081 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1039404125 8:37298164-37298186 CAGGCCCAGGCCCAGGCTCTAGG - Intergenic
1039692964 8:39881426-39881448 CAGGCACTGGCACAAGATCTAGG - Intergenic
1039839264 8:41281797-41281819 AAGGCACAGTCTCAAGATCTAGG + Intronic
1039953628 8:42191069-42191091 CGGCCACTGGCCCAAGGTCCTGG - Intronic
1039999465 8:42564085-42564107 CAGGCACTGACCCAAGATCTAGG - Intergenic
1040548350 8:48419671-48419693 CAGGCTCCGGCCCAAGGTCGAGG + Intergenic
1040649181 8:49430397-49430419 CAGGCACTGGCCCAAGATCGAGG + Intergenic
1040667656 8:49652942-49652964 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1040796621 8:51295204-51295226 CACCCACTGGCCCAAGCTCTAGG - Intergenic
1040953625 8:52958720-52958742 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1040964844 8:53073027-53073049 CAGGCACTGGCCCAAGACCTAGG - Intergenic
1042772129 8:72392019-72392041 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1042919828 8:73910072-73910094 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1044005218 8:86930447-86930469 CATGCACTGGCCCAAGATCTAGG - Intronic
1044456409 8:92396818-92396840 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1044628642 8:94258449-94258471 CTGGCTCTGGCCTAAGCTCTGGG - Intronic
1045062618 8:98422686-98422708 CAGGCCCTGCCCTAAGACCTGGG + Intronic
1045929102 8:107602692-107602714 CAGGCATTGGCCCAAGACCTAGG - Intergenic
1049344746 8:142132855-142132877 CAGGCACTGCCCCAGGCACTCGG - Intergenic
1049545448 8:143228659-143228681 CAGGCACAGGCCCCAGTCCTTGG + Intergenic
1049909202 9:249141-249163 TTGGCACTGGCCCAAGATCCTGG - Intronic
1051017840 9:12502544-12502566 CAGACACTGCCTCAAGATTTGGG + Intergenic
1051600151 9:18864445-18864467 AAGCCACTGGCCAAAAATCTTGG + Intronic
1051935489 9:22438615-22438637 CAGGCACTGGCCCGAGATCTAGG + Intergenic
1052057558 9:23921802-23921824 CAGGCACTAGCCCAAGATCTAGG - Intergenic
1052289725 9:26827428-26827450 CAGGCACTGGCCCAATATCTAGG + Intergenic
1054831585 9:69631082-69631104 CAGGCATTGGCCAGAGAACTTGG - Intronic
1056392562 9:86153210-86153232 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1056773174 9:89494381-89494403 CAGGCGCTGCCCCAGGCTCTAGG - Intronic
1057902531 9:98960737-98960759 CAGGCACTGTGCTAAGAGCTTGG - Intronic
1058628566 9:106961586-106961608 CAGCCACTGGACTAAGTTCTGGG + Intronic
1060732056 9:126044875-126044897 CAGGCACTGCTTCAAGGTCTGGG + Intergenic
1061534021 9:131236459-131236481 CAGGCTCTGGCCTGACATCTGGG + Intergenic
1062357965 9:136173955-136173977 CAGGCACTGACCCCACATCAGGG + Intergenic
1186337039 X:8600850-8600872 GAGGCACTGGCCAATGATTTTGG - Intronic
1188097745 X:26044187-26044209 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1188136730 X:26501539-26501561 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1188672683 X:32898942-32898964 CAGGCACTGTTCCAAGTGCTTGG + Intronic
1189196340 X:39156557-39156579 CAGGCACTGGGCTAGGAGCTGGG + Intergenic
1189539963 X:41976879-41976901 CAGGCACTGCACCATGAGCTGGG + Intergenic
1192482538 X:71498139-71498161 CAGGCACTGGCGCAAGGTCTAGG - Intronic
1192543705 X:71995858-71995880 CAGGCACTGGTCCAGGCACTAGG - Intergenic
1195439788 X:104886824-104886846 CAGGCACTGGCCCAGGATCTAGG + Intronic
1195461082 X:105125243-105125265 CAGGCACTGTGCTAAGTTCTGGG - Intronic
1196127139 X:112112725-112112747 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1197513623 X:127399084-127399106 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1197689153 X:129478291-129478313 CAGGTACTGGGCCAAGTACTTGG - Intronic
1199782537 X:151075796-151075818 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1199832186 X:151558146-151558168 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1200176680 X:154122014-154122036 CTGGCTCTGGCCCAGGCTCTTGG - Intergenic
1200296126 X:154922416-154922438 CAGGCACTGTTCAAAGTTCTGGG + Intronic
1200361782 X:155614157-155614179 CAGGCACTGTACTAAGATCTGGG + Intronic
1200687918 Y:6273636-6273658 CAGGCCCTGGCTGATGATCTGGG + Intergenic
1200776413 Y:7173858-7173880 TAGGCACTGGCCCAAGATCTAGG + Intergenic
1200800814 Y:7385824-7385846 CAGGCACTGGCCCACAGTCTAGG - Intergenic
1200880612 Y:8208333-8208355 CAAGCACTAGTCCAAGATCTAGG - Intergenic
1200959499 Y:8983942-8983964 CAGGCACTGTCCCAAGATCTAGG + Intergenic
1200979425 Y:9248315-9248337 CAGGCCCTGGCTGATGATCTGGG + Intergenic
1200988609 Y:9327863-9327885 CAGGCTCTGGCTGATGATCTAGG - Intergenic
1200989240 Y:9334383-9334405 TAGGCCCTGGCTCATGATCTAGG + Intergenic
1201018331 Y:9626315-9626337 CAGGCCCTGGCTGACGATCTGGG - Intergenic
1201047349 Y:9901066-9901088 CAGGCCCTGGCTGATGATCTGGG - Intergenic
1201062409 Y:10059206-10059228 CAGGCCCTGGCTGATGATCTGGG - Intergenic
1201311854 Y:12604651-12604673 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201382691 Y:13401224-13401246 CAGACATGGTCCCAAGATCTAGG + Intronic
1201403976 Y:13631950-13631972 TAGGCACTGGCCCAATATCTAGG + Intergenic
1201429895 Y:13893003-13893025 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1201455320 Y:14162301-14162323 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1201472985 Y:14353859-14353881 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201487782 Y:14510389-14510411 CAGGCTCTGGCCCAAGATCTAGG + Intergenic
1201530738 Y:14987522-14987544 TAGGCACTGGCCCAAGATCTAGG + Intergenic
1201555950 Y:15264780-15264802 CAGGCACTGGCCCAAAATCTAGG + Intergenic
1201640057 Y:16168804-16168826 CAGGCACTGGCCCGGGACCTAGG - Intergenic
1201662756 Y:16416521-16416543 CAGGCACTGGCCCGGGACCTAGG + Intergenic
1201729391 Y:17188564-17188586 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201743802 Y:17349875-17349897 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201908033 Y:19105137-19105159 CAGACACTGGCCCATGATATAGG - Intergenic
1201911264 Y:19135613-19135635 CTGGCACTGGCCCAAGATCTAGG + Intergenic
1202110144 Y:21409286-21409308 CAGGCTCTGGCTGATGATCTGGG - Intergenic
1202119381 Y:21508329-21508351 CAGGCTCTGGCTGATGATCTAGG + Intergenic
1202121833 Y:21531869-21531891 CAGGCTCTGGCTGATGATCTAGG + Intronic
1202157173 Y:21897513-21897535 CAGGCTCTGGCTGATGATCTAGG - Intronic
1202159619 Y:21921054-21921076 CAGGCTCTGGCTGATGATCTAGG - Intergenic
1202161746 Y:21941513-21941535 CAGGCCCTGGCTGATGATCTGGG - Intergenic
1202192405 Y:22258831-22258853 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1202196759 Y:22305798-22305820 CAGGCTCTGGCTGATGATCTGGG + Intergenic
1202229610 Y:22644860-22644882 CAGGCCCTGGCTGATGATCTGGG + Intergenic
1202243080 Y:22790221-22790243 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202258081 Y:22941375-22941397 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202271829 Y:23080858-23080880 CAGGCACTGGCCCAAGATCTTGG - Intergenic
1202294197 Y:23339824-23339846 CAGGCACTGGCCCAAGATCTTGG + Intergenic
1202313546 Y:23551305-23551327 CAGGCCCTGGCTGATGATCTGGG - Intergenic
1202396067 Y:24423971-24423993 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202411071 Y:24575133-24575155 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202424826 Y:24714602-24714624 CAGGCACTGGCCCAAGATCTTGG - Intergenic
1202445963 Y:24955483-24955505 CAGGCACTGGCCCAAGATCTTGG + Intergenic
1202459710 Y:25094939-25094961 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1202474718 Y:25246121-25246143 CAGGCATTGGCCCAAGATCTAGG - Intergenic
1202557257 Y:26119290-26119312 CAGGCCCTGGCTGATGATCTGGG + Intergenic