ID: 1033759018

View in Genome Browser
Species Human (GRCh38)
Location 7:144420868-144420890
Sequence GTGCCTGACCAAACATATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033759015_1033759018 -7 Left 1033759015 7:144420852-144420874 CCTAGATCTTGGGCCAGTGCCTG 0: 90
1: 71
2: 21
3: 37
4: 362
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data
1033759010_1033759018 19 Left 1033759010 7:144420826-144420848 CCAGAGTGCCTGGACTTCAGAAG No data
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data
1033759012_1033759018 11 Left 1033759012 7:144420834-144420856 CCTGGACTTCAGAAGTGGCCTAG No data
Right 1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033759018 Original CRISPR GTGCCTGACCAAACATATGA GGG Intergenic
No off target data available for this crispr