ID: 1033768330

View in Genome Browser
Species Human (GRCh38)
Location 7:144520083-144520105
Sequence CTCCACAGTTGAGGTCTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033768327_1033768330 -3 Left 1033768327 7:144520063-144520085 CCTTTTCTCAGCTCCATCTACTC 0: 1
1: 0
2: 6
3: 40
4: 395
Right 1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 146
1033768326_1033768330 3 Left 1033768326 7:144520057-144520079 CCAAATCCTTTTCTCAGCTCCAT 0: 1
1: 0
2: 3
3: 31
4: 443
Right 1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033768330 Original CRISPR CTCCACAGTTGAGGTCTCTT CGG Intronic
901237688 1:7676265-7676287 CTCCACAGTGGAGGTCACATAGG - Intronic
902169742 1:14599738-14599760 CTTCTCATTTGAGGTCTCTCAGG + Intronic
902223553 1:14982126-14982148 CTTTACAGTTGAGGTCACTGAGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908146706 1:61253708-61253730 TTCAAAAATTGAGGTCTCTTTGG - Intronic
909926011 1:81438910-81438932 CTCCAGATTTGAGGGCCCTTAGG - Intronic
912139094 1:106699628-106699650 CTCTACAGATCAGGTCCCTTGGG + Intergenic
912254426 1:108044609-108044631 CTCCACCATAGAGTTCTCTTTGG - Intergenic
915334745 1:155134554-155134576 CTCCACAGATGAGGTCTTGCTGG - Exonic
915891154 1:159775014-159775036 ATCCACAGTTGATGTCACATGGG - Intergenic
916144676 1:161727634-161727656 CTCCACAGGAGTGGTCTCTGGGG - Exonic
920363135 1:205433071-205433093 CTCTACAGTTGTGTTCTCTCAGG + Intronic
920570855 1:207016282-207016304 CCCGACACTTGAGGGCTCTTAGG - Intronic
921348534 1:214211909-214211931 CTCCACAGCTAAGGTGTCCTTGG + Intergenic
1062975436 10:1679142-1679164 CTCCACAGCTGGGTTATCTTCGG - Intronic
1064152753 10:12878535-12878557 CTCCAGAGTTGAGTTCTGTCAGG - Intergenic
1072090801 10:92125405-92125427 TACCACTGTTGAGGCCTCTTGGG - Intronic
1072317418 10:94216251-94216273 CTGCCCAGTTGAGATCTCCTCGG + Intronic
1076314101 10:129528618-129528640 CTCCACACGGCAGGTCTCTTTGG - Intronic
1077327859 11:1971440-1971462 CTCCACAGCTGGGGCCTCTCCGG + Intronic
1077807574 11:5604894-5604916 CTCTACAGTTTCAGTCTCTTTGG + Intronic
1077904851 11:6523287-6523309 CTGCACAGGGAAGGTCTCTTTGG + Intronic
1078274217 11:9827227-9827249 CTTCACAGTTGAGATATCTGGGG + Intronic
1085233047 11:74989185-74989207 CCCCACAGTTGAGTCCTCCTCGG - Intronic
1085772636 11:79338823-79338845 CTCCACAGTTGAGGAAACTGAGG - Intronic
1086871135 11:92038030-92038052 CTCCTCAGTTAAAGTATCTTTGG - Intergenic
1088930571 11:114347293-114347315 CTCCGCAGTTGAGGTTTCCTCGG + Intergenic
1202810839 11_KI270721v1_random:26620-26642 CTCCACAGCTGGGGCCTCTCCGG + Intergenic
1091961032 12:4694559-4694581 CACCACAGGTGAGTTTTCTTAGG - Intronic
1092943497 12:13432300-13432322 CTCCACAGAAGAGGTGCCTTTGG - Intergenic
1094010408 12:25803182-25803204 GTCAACAGGTGAGGTCTCTGGGG + Intergenic
1094260295 12:28489203-28489225 CTAGACAATTGAAGTCTCTTAGG + Intronic
1094693060 12:32788589-32788611 GTGAACAGTGGAGGTCTCTTTGG - Intergenic
1094756566 12:33476883-33476905 CTCCACAGTTCTGGGATCTTGGG - Intergenic
1098482363 12:70979565-70979587 CTCCACTGTTGATGGCTATTTGG - Intergenic
1098684530 12:73401601-73401623 CTCCACATTTTTGTTCTCTTTGG - Intergenic
1101240487 12:102833261-102833283 CTCTACAGTTGTCATCTCTTTGG + Intergenic
1101471315 12:104999556-104999578 CTCTAGGGTTGAAGTCTCTTAGG + Intronic
1111390832 13:87592377-87592399 TTTCATATTTGAGGTCTCTTTGG - Intergenic
1112172917 13:96992944-96992966 CTCCAAAGCTGGGGTCACTTTGG + Intronic
1114082554 14:19213927-19213949 CACCAAAGTTTAGGTCTCCTGGG - Intergenic
1114339568 14:21728953-21728975 CTCCACAGTGTTGGTGTCTTAGG - Intergenic
1114430345 14:22655429-22655451 CTCCCCATTTTAGGTCACTTAGG - Intergenic
1115620712 14:35137345-35137367 CTCCACATTTGTGCTCTTTTTGG - Intronic
1119875984 14:78059857-78059879 TTACACAGCTGAGGTCTGTTGGG - Intergenic
1120546215 14:85814450-85814472 ATGCACAGTTGAGCTCTCTGTGG - Intergenic
1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG + Intronic
1126911300 15:53419769-53419791 GTCCACAGATGAGGTCCCTCAGG + Intergenic
1127976445 15:64000711-64000733 CTGCACAGTAGAGGTCTTTGGGG + Intronic
1128226097 15:66002326-66002348 CTCCTCAGTAGAGCTCTCTAGGG + Intronic
1132579945 16:680204-680226 CTGCCCTGCTGAGGTCTCTTCGG - Intronic
1133388686 16:5391450-5391472 CTCCACATGTAAGGTCCCTTGGG + Intergenic
1135149107 16:19989852-19989874 CTCCAGAGTGGAGGTCATTTGGG + Intergenic
1137902007 16:52278965-52278987 CTCCTCAGTTGAATGCTCTTTGG + Intergenic
1138756420 16:59491809-59491831 CTGCAAATTTGAGGTCTCTATGG + Intergenic
1142154945 16:88528615-88528637 CTCCACAGTGGAGGTGTCCCTGG + Intronic
1142858179 17:2744719-2744741 CTCCTTGTTTGAGGTCTCTTGGG - Intergenic
1142899332 17:3002630-3002652 CTCCCCAGTGGAGGCCTCCTGGG - Intronic
1146569585 17:33941139-33941161 CACCACAGTTGAGCTCACCTAGG - Intronic
1149627680 17:58091227-58091249 CTGCACTGTTTGGGTCTCTTTGG + Exonic
1152668038 17:81582863-81582885 CTCCACAGCTGCAGGCTCTTGGG + Intronic
1153273638 18:3347619-3347641 CTTCACAGTTGAGGTCACTGAGG + Intergenic
1154090860 18:11361678-11361700 CTCCCCAGTTCAGGTATATTTGG - Intergenic
1156658535 18:39317319-39317341 CTCCCCAGTTTCTGTCTCTTTGG - Intergenic
1164728551 19:30483623-30483645 CTCCACATTTGAGGTCTTCATGG + Intronic
1165953970 19:39490137-39490159 CTCCACAGATGAGGAGTCTGTGG - Exonic
1168394110 19:56033608-56033630 CTCCCAAGTTGAGGGATCTTAGG - Exonic
926112484 2:10192139-10192161 CTCCTCTTTTGAGCTCTCTTGGG - Intronic
927161553 2:20267694-20267716 TTCCACAGATGAGGTCACTATGG + Intronic
931477513 2:62604629-62604651 CTCAGCAGTTGAGCACTCTTGGG + Intergenic
934579708 2:95428195-95428217 TTCCACAGGTGAGGTCACTGGGG + Intergenic
934599738 2:95648530-95648552 TTCCACAGGTGAGGTCACTGGGG - Intergenic
935673474 2:105574976-105574998 TTCCAAAATTCAGGTCTCTTAGG - Intergenic
936533078 2:113290534-113290556 TTCCACAGGTGAGGTCACTGGGG - Intergenic
937462198 2:122099147-122099169 CTCCCCTGCTGAGGTATCTTGGG + Intergenic
938494030 2:131782678-131782700 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
945538833 2:211056835-211056857 CTCCCCCGTTCAGATCTCTTCGG + Intergenic
945812786 2:214568899-214568921 CAACACAGTTGGGGTCCCTTAGG - Intronic
946672035 2:222115305-222115327 CACCAAAGATGAGGTCTCTGTGG + Intergenic
946996318 2:225396113-225396135 CTCCACTCTTAAGGACTCTTAGG + Intergenic
947642259 2:231713748-231713770 CTCCCCAGTTAAGGCTTCTTGGG - Intergenic
947835096 2:233169567-233169589 CTCCACACGTGAGGTCACTATGG - Intronic
1172411164 20:34724189-34724211 CACCACAGTCAGGGTCTCTTAGG - Intronic
1172513082 20:35514096-35514118 TTCCCCACTTCAGGTCTCTTTGG - Exonic
1174075706 20:47934520-47934542 CTCCAATCTTGATGTCTCTTTGG - Intergenic
1174528973 20:51195975-51195997 CTTTACAGTTGAGGTCACTGGGG + Intergenic
1174549905 20:51354828-51354850 CTCCACAGCTGAGGAGTCTTTGG - Intergenic
1174568087 20:51481357-51481379 CTCCAAAGGTGAGGTCTTCTCGG + Intronic
1174568915 20:51487189-51487211 TTCCCCAGTTGCCGTCTCTTGGG - Intronic
1176234260 20:64047027-64047049 CTCCAGAGTTGGGGGGTCTTGGG + Intronic
1176613890 21:9011689-9011711 CACCAAAGTTTAGGTCTCCTGGG - Intergenic
1176711311 21:10152200-10152222 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
1180149125 21:45938722-45938744 CTCCAGAGTGGGGGTCTCTGTGG + Intronic
1180498223 22:15908743-15908765 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
1181130236 22:20726895-20726917 CTCCACGGGTGAGGTCACTGTGG + Intronic
1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG + Exonic
949765181 3:7518165-7518187 CACCACAGCTGTGCTCTCTTGGG - Intronic
952288674 3:31993966-31993988 TTCCCCAGTTGAGGGATCTTTGG - Intronic
953358726 3:42276629-42276651 CTCCTCAGTTCAGCTCTCTGGGG - Intergenic
957131237 3:76224458-76224480 CTCCACAATTATGTTCTCTTTGG + Intronic
958047579 3:88303816-88303838 CTCCATGGTTGCTGTCTCTTCGG - Intergenic
959294979 3:104523393-104523415 CTCTACAGTTTTGGTATCTTTGG - Intergenic
959623203 3:108421400-108421422 CTGCAAAGTTTAGGCCTCTTGGG - Intronic
960540003 3:118851569-118851591 CTCTGCAGTTGAGGTTTCCTGGG - Intergenic
961614408 3:128167462-128167484 CTCCACTGTTGAACTCTATTTGG - Intronic
964402932 3:156318099-156318121 CAGCACACTTGAGGTCTCCTTGG - Intronic
965106218 3:164358412-164358434 CTCCACAGTTTTGATCTGTTGGG + Intergenic
967757543 3:193187000-193187022 CTTCAGATTTGAGCTCTCTTGGG - Intergenic
971601186 4:28594149-28594171 CTGCACAGATGAGGGCCCTTGGG + Intergenic
977795390 4:101158624-101158646 GGCCACAGTTGAGGTCACTGAGG - Intronic
980452942 4:132998804-132998826 CTCTACAGTTCTGGTGTCTTGGG + Intergenic
986311977 5:6557621-6557643 TGCCTCAGCTGAGGTCTCTTAGG - Intergenic
986350083 5:6869028-6869050 CATCACAGTGGAGGTGTCTTGGG + Intergenic
994422446 5:99537751-99537773 ATTTACAGTTGAGGTCTGTTTGG - Intergenic
994425755 5:99584746-99584768 ATTTACAGTTGAGGTCTGTTTGG + Intergenic
994459926 5:100059787-100059809 ATTTACAGTTGAGGTCTGTTTGG + Intergenic
995585342 5:113642720-113642742 GTCCACACTTGAGCTCTCTAAGG - Intergenic
997622859 5:135310617-135310639 GTCAACAGTTGAGAGCTCTTAGG + Intronic
998278799 5:140784398-140784420 CTCCACAGTTGTGGTATCAGAGG - Intergenic
999120901 5:149208700-149208722 CTTCCCAGTTGAGGTCCCTGTGG - Intronic
999148132 5:149409200-149409222 CTCCACAGATGAGGTACCTGAGG + Intergenic
1004481410 6:16023140-16023162 CTCCCTTGCTGAGGTCTCTTTGG + Intergenic
1004571589 6:16850880-16850902 CTCCACAGTTCAGGGCACTTTGG + Intergenic
1005019375 6:21403003-21403025 CTCTAAAGTTGAGTTCTCTGCGG + Intergenic
1005994380 6:30922521-30922543 CCCCACTGATGATGTCTCTTGGG - Exonic
1006135943 6:31896810-31896832 CTCTACAGTTCATGGCTCTTTGG - Exonic
1008150314 6:47942214-47942236 CTCCCCAGTTGGGATCCCTTTGG - Intronic
1019281195 7:201104-201126 CTCCACATCTGAGCCCTCTTTGG + Intronic
1019842034 7:3456902-3456924 CTCTAAAATTGAGGTCTCATTGG - Intronic
1021924429 7:25520993-25521015 CTGCACAATTGGTGTCTCTTTGG + Intergenic
1022808723 7:33848648-33848670 TTCCACAGTAGAGGTCCCCTGGG + Intergenic
1024242895 7:47448942-47448964 CTCCACAGATGGGGTCACTGAGG - Intronic
1024928836 7:54647685-54647707 TTCCAAACTTCAGGTCTCTTAGG - Intergenic
1029200123 7:98833830-98833852 CTCCACAGCAGAGCTCTCTGAGG - Intergenic
1030397161 7:109000823-109000845 CCTCATAGTTAAGGTCTCTTTGG + Intergenic
1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG + Intronic
1037584654 8:20268323-20268345 CTCCCCAGCAGAGGTCTCTCTGG + Intronic
1039147134 8:34460808-34460830 CTCCCCAGTTGGGTTCTCCTGGG - Intergenic
1045055383 8:98364010-98364032 CTTCCCAGCTGAGGTCTGTTTGG - Intergenic
1045270542 8:100657550-100657572 CTCCCCAAATGAGGTCTCCTTGG - Intronic
1051993006 9:23176107-23176129 CTCCAAAATTGAGGACTGTTTGG + Intergenic
1053200169 9:36146893-36146915 CTCCACAGTTCTGGGGTCTTGGG + Intronic
1053317240 9:37062452-37062474 CTCTAAAGTTGAGGTCTCAAGGG + Intergenic
1053648300 9:40137891-40137913 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
1053757439 9:41325950-41325972 CACCAAAGTTTAGGTCTCCTGGG - Intergenic
1054329274 9:63735834-63735856 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
1054536282 9:66238279-66238301 CACCAAAGTTTAGGTCTCCTGGG - Intergenic
1056075232 9:83031559-83031581 CTCCAGAGTTGGGCTCTCTAGGG + Intronic
1057635354 9:96759858-96759880 CTCCACAGTTGACTTCTCAAAGG + Exonic
1062488399 9:136792243-136792265 CTCCACAGTTGCAGGCTCTGTGG + Exonic
1202796066 9_KI270719v1_random:121189-121211 CACCAAAGTTTAGGTCTCCTGGG + Intergenic
1192022683 X:67410610-67410632 CCCCAGAGTTGAGGACTCCTCGG + Intergenic