ID: 1033768330

View in Genome Browser
Species Human (GRCh38)
Location 7:144520083-144520105
Sequence CTCCACAGTTGAGGTCTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033768327_1033768330 -3 Left 1033768327 7:144520063-144520085 CCTTTTCTCAGCTCCATCTACTC 0: 1
1: 0
2: 6
3: 40
4: 395
Right 1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 146
1033768326_1033768330 3 Left 1033768326 7:144520057-144520079 CCAAATCCTTTTCTCAGCTCCAT No data
Right 1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033768330 Original CRISPR CTCCACAGTTGAGGTCTCTT CGG Intronic