ID: 1033772062

View in Genome Browser
Species Human (GRCh38)
Location 7:144563898-144563920
Sequence CATGTTCCCTTATAAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033772062_1033772067 14 Left 1033772062 7:144563898-144563920 CCTCTGCCTTATAAGGGAACATG 0: 1
1: 0
2: 1
3: 10
4: 199
Right 1033772067 7:144563935-144563957 TTACCCCTCTTATCCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033772062 Original CRISPR CATGTTCCCTTATAAGGCAG AGG (reversed) Intronic
901451867 1:9340731-9340753 CATGTTACCTTTGCAGGCAGAGG - Intronic
901575719 1:10199163-10199185 CATGTAGCCTTATAAGGGGGAGG - Intergenic
903462958 1:23531727-23531749 CCTGTTCCCTTTAATGGCAGAGG + Intergenic
904957360 1:34296205-34296227 CATGTTTCCAAAAAAGGCAGTGG - Intergenic
907147568 1:52249187-52249209 CATGTTCCCTGTTAAGTCTGTGG + Intronic
907307792 1:53523191-53523213 CATGTTCCCTGAGGAGGGAGGGG - Intronic
907670161 1:56467345-56467367 CAGGTTCCCTCAGAAGCCAGTGG - Intergenic
908800379 1:67873856-67873878 CATAGTCCCTTATAGGGGAGAGG - Intergenic
910190346 1:84588426-84588448 CATATATCCTCATAAGGCAGGGG + Intergenic
910961589 1:92769542-92769564 TATGTTATCTTATACGGCAGAGG + Intronic
911390571 1:97236131-97236153 GGTGTTCCCTTATAAGTCAGGGG + Intronic
912245014 1:107952687-107952709 TATTTTCCCTTATAAAACAGTGG - Intronic
913674855 1:121131033-121131055 TATGTTACCTTATATGGCAAAGG - Intergenic
914026694 1:143918665-143918687 TATGTTACCTTATATGGCAAAGG - Intergenic
914665076 1:149826100-149826122 TATGTTACCTTATATGGCAAAGG - Intergenic
914670689 1:149867721-149867743 TATGTTACCTTATATGGCAAAGG + Intronic
920535783 1:206735797-206735819 TATGTTCCCTTACATGGCAAAGG - Intergenic
921676654 1:217983497-217983519 CATGTTCCCATCTGAGGCTGTGG + Intergenic
922565440 1:226598415-226598437 CATGTTCCGCTTTAATGCAGAGG - Intronic
923312429 1:232747947-232747969 CAAGTTTCCTTATAAGGTAGAGG - Intergenic
923934160 1:238743044-238743066 CATGGACCCTTCTAAGACAGGGG - Intergenic
924896088 1:248339192-248339214 CCAGTTCCCTTATTAGGCCGAGG - Intergenic
1063006627 10:1977694-1977716 CTTGTGCTCTTATAAGCCAGAGG + Intergenic
1065128812 10:22600319-22600341 CATGTTCCCTTATACGAGGGTGG - Intronic
1067698739 10:48553687-48553709 TATGTTACCTTATATGGCAAAGG + Intronic
1067914130 10:50377914-50377936 TATGTATCCTTATAAGACAGGGG - Intronic
1068605599 10:59001841-59001863 AATTTTCCATTATAAGCCAGTGG - Intergenic
1069201758 10:65627886-65627908 GATGTTCTTTTAAAAGGCAGTGG - Intergenic
1070805334 10:79267388-79267410 CATGTTCCCTTGGGATGCAGAGG - Intronic
1075182854 10:120227591-120227613 CAAGTATCCTTATAAGGGAGAGG - Intergenic
1078391112 11:10936051-10936073 CATGTTACCTTATGTGGCAAAGG - Intergenic
1080347550 11:31341902-31341924 CATGTTGCCTTGCAAGGCTGAGG + Intronic
1081120189 11:39256515-39256537 CTTGTACCCTCATAAGGCATGGG + Intergenic
1081159792 11:39737147-39737169 CCAGTTCCCTTATTAGGCTGAGG + Intergenic
1081597993 11:44472518-44472540 TATGTTACCTTATATGGCAAAGG + Intergenic
1085646960 11:78230589-78230611 CATGTGCTCCTAGAAGGCAGAGG + Intronic
1087070894 11:94079440-94079462 CATGATGCTTTAGAAGGCAGTGG - Intronic
1088100334 11:106147275-106147297 CATCTTGCCATATAAGGCAGTGG - Intergenic
1088570438 11:111218732-111218754 CAAGTTCCTTTTTGAGGCAGTGG - Intergenic
1090915149 11:131156442-131156464 AATATTGCCTTACAAGGCAGAGG + Intergenic
1091830801 12:3550052-3550074 CATGTTCGCTGCCAAGGCAGGGG + Exonic
1095346371 12:41154371-41154393 CATGTTCACTTTTGAGGCATGGG - Intergenic
1098994930 12:77108288-77108310 CATGTCTCCTTCCAAGGCAGTGG + Intergenic
1102716302 12:114975904-114975926 CATCTTTCCTTACAAGGAAGTGG + Intergenic
1102920323 12:116786962-116786984 CATGTGTCCTTATAAGAGAGAGG - Intronic
1103750037 12:123151863-123151885 CTTGTCACCTTATAAGGCTGAGG + Intergenic
1104409550 12:128546840-128546862 TATGTTACCTTACAAGGCAAAGG - Intronic
1104409808 12:128548590-128548612 TATGTTACCTTATAAGTCAAAGG - Intronic
1106131189 13:26940850-26940872 TATGTTGCATTATATGGCAGGGG + Intergenic
1107830148 13:44367842-44367864 CATGTACATTTATAAGGCTGTGG + Intergenic
1109203900 13:59460529-59460551 CTTGTGCCCTTATAAGAGAGGGG - Intergenic
1109465117 13:62721595-62721617 CATGTTATATTATATGGCAGAGG + Intergenic
1111252261 13:85617467-85617489 CATGTTGCCTCATAAGGTTGTGG + Intergenic
1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG + Intergenic
1111377568 13:87400645-87400667 CATGTGCCCTTTTAAAGGAGAGG + Intergenic
1111477266 13:88767193-88767215 CATGTACCTTTAAAAGACAGAGG - Intergenic
1111489884 13:88958623-88958645 CATGTTCCTTCATAAGGAATAGG + Intergenic
1113973382 13:114207727-114207749 CAGTTTTCCCTATAAGGCAGAGG - Intergenic
1116213124 14:41973248-41973270 CATGTTTCCTTTTAAGTCTGTGG - Intergenic
1116332480 14:43613524-43613546 AATGTTCCCTCATAAAGCATGGG + Intergenic
1118451143 14:65903544-65903566 CATGTTACCTTACATGGCAAAGG + Intergenic
1118467294 14:66042519-66042541 CATGTCTCCTTATAAGGGAGAGG - Intergenic
1118474251 14:66102104-66102126 CATGTTCCCATATAGGGCCTCGG - Intergenic
1120090298 14:80324163-80324185 CATGTTACCTTACAAGGCAAAGG + Intronic
1121561137 14:94876413-94876435 CAAGCTCTCTAATAAGGCAGTGG + Intergenic
1121587661 14:95074056-95074078 AAGGTTACCTTATAAGGCAAAGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1128535660 15:68488291-68488313 CATTTAACCTTATGAGGCAGAGG + Intergenic
1128539686 15:68517942-68517964 CATGTACCCTCATAAGGCCAGGG + Intergenic
1128878882 15:71224918-71224940 AATGTTACCTTATATGGCAATGG - Intronic
1128884533 15:71274470-71274492 CATGCCCCCTTATGATGCAGTGG - Intronic
1131587530 15:93712251-93712273 CATGTTGCCTGATAAGAAAGAGG - Intergenic
1135653582 16:24228081-24228103 CGAGTTTCCTTACAAGGCAGAGG + Intergenic
1137323064 16:47406052-47406074 TATGTTCTCTGATAAGGAAGGGG - Intronic
1139494456 16:67306266-67306288 AATGTTCCCTTCTAATGCTGTGG - Intronic
1140040220 16:71402539-71402561 CATGTGCCCTTACCAGGAAGAGG - Intergenic
1141221109 16:82070087-82070109 CATCTTCCCTTATACTCCAGAGG + Intronic
1148964885 17:51426816-51426838 CATGTTGCTTTACATGGCAGAGG + Intergenic
1149179951 17:53923884-53923906 CATGTTACCTTATATGGCAAAGG + Intergenic
1149456112 17:56789815-56789837 AATGTTACCTTATATGGCAAGGG + Intergenic
1150066488 17:62113995-62114017 CATGATGTCTTATAGGGCAGTGG - Intergenic
1151015857 17:70551895-70551917 CATGTACCCTTACTAGGCAATGG - Intergenic
1151432409 17:74072416-74072438 CATGTGTCCTTATAAGGAAAAGG - Intergenic
1203171949 17_GL000205v2_random:156740-156762 CAAGGTCCCTTATGAGGCTGGGG - Intergenic
1153911684 18:9710267-9710289 CATGTTCCCCCTTTAGGCAGAGG + Intronic
1158449607 18:57552271-57552293 CATTTTCAGTTATTAGGCAGTGG - Intronic
1158713484 18:59857885-59857907 CAGGTTCCTTTCAAAGGCAGTGG + Intergenic
1158825666 18:61215983-61216005 CATTTGCCCATATAAGTCAGAGG + Intergenic
1159950080 18:74476500-74476522 TATGTTACCTTATATGGCAAAGG + Intergenic
1164257850 19:23544826-23544848 GCTGTTCCCTTAGAAGGCATTGG - Intronic
1166498845 19:43326471-43326493 CCAGTTCCCTTATTAGGCTGAGG - Intergenic
1167342641 19:48924926-48924948 CATGTTCCCTTATATCCCACTGG + Intergenic
1167446136 19:49538733-49538755 CATGTTCACACATAAAGCAGAGG + Intronic
925554963 2:5120931-5120953 TATGTCCCCTTAGAAGGGAGGGG + Intergenic
926239513 2:11074409-11074431 GGTGTTCCCATCTAAGGCAGTGG + Intergenic
926334342 2:11851915-11851937 CATATTCCCTCATGAGCCAGTGG - Intergenic
927509966 2:23638340-23638362 AATATTCCATTATAAGGCTGTGG + Intronic
928686866 2:33759071-33759093 TATATTACCTTATATGGCAGGGG + Intergenic
929572432 2:43031000-43031022 CATGATCCCTTCCACGGCAGAGG + Intergenic
931857303 2:66316704-66316726 GGGGGTCCCTTATAAGGCAGTGG + Intergenic
934103033 2:88671139-88671161 AATGTTACCTTATATGGCAAAGG + Intergenic
934770983 2:96907492-96907514 CCTGTTGCCTTATATGACAGTGG - Intronic
935134234 2:100285519-100285541 TATGGTACCTTATATGGCAGAGG + Intronic
935280849 2:101516529-101516551 GACTTTCCCTTATAAGGAAGTGG - Intergenic
935640622 2:105286582-105286604 CATCCTTCATTATAAGGCAGTGG + Intronic
935897737 2:107755744-107755766 TATGTATCCTTATAAGACAGAGG - Intergenic
936744220 2:115554943-115554965 AATGTTCCCTTCTAATACAGGGG + Intronic
937169876 2:119855360-119855382 CAAGTTCCCTTACAAGGCCTTGG + Intronic
939612267 2:144326184-144326206 TATGTTGCCTTGTAAGGCATTGG - Intronic
941240602 2:163031871-163031893 GATGTTACCTTATATGGCAAAGG + Intergenic
942655129 2:178207355-178207377 CATGTATCCTTGTAAGACAGAGG - Intronic
943351353 2:186799958-186799980 CATGTTCACTTATAAGTCAGAGG - Intergenic
945230978 2:207589500-207589522 TATGTTACCTTATATGGCAAAGG - Intronic
945235731 2:207629680-207629702 CATGTTCCCTTTTTAGGCCAGGG + Intergenic
947903529 2:233742674-233742696 CATGTTCCCTCTGAAGGCTGAGG - Intronic
948173777 2:235927708-235927730 CAATTTCCTTTAAAAGGCAGAGG - Intronic
1172884272 20:38220997-38221019 CATTTTCCCTCTGAAGGCAGAGG - Intronic
1174562035 20:51438179-51438201 CATGTCCCCTTTTCAGGTAGAGG + Intronic
1175480481 20:59307201-59307223 CATGTGGCCATATGAGGCAGAGG + Intronic
1179374247 21:40835420-40835442 CATGTTCCTTTAAAAGGGGGTGG - Intronic
1183175580 22:36222668-36222690 CAAGGGTCCTTATAAGGCAGAGG - Intergenic
956570834 3:70692781-70692803 GATGTACCTTTATAAGGCACTGG + Intergenic
956737849 3:72252068-72252090 TATGTTCCCTTGAAAAGCAGAGG - Intergenic
956872270 3:73429805-73429827 CAGGTTGCCTGATAAGCCAGTGG + Intronic
957059812 3:75472992-75473014 CCAGTTCCCTTATTAGGCTGAGG - Intergenic
958162832 3:89838580-89838602 CATGCTGCCTTATAACACAGTGG + Intergenic
959511306 3:107215798-107215820 AAACTTCCCTGATAAGGCAGTGG + Intergenic
959578858 3:107963832-107963854 CATGTTGTCTTGCAAGGCAGAGG + Intergenic
960748552 3:120918295-120918317 TATGTTAGCTTATATGGCAGAGG - Intronic
960877963 3:122315612-122315634 CCTCTGTCCTTATAAGGCAGAGG + Intergenic
963223513 3:142836948-142836970 TATGTTTCTTTATAAGGCAAAGG + Intronic
965491910 3:169348127-169348149 AATGTTCCCTGAGAAAGCAGTGG + Intronic
966544126 3:181125612-181125634 CATGTGCCCTTATAAAATAGAGG - Intergenic
967821878 3:193846185-193846207 CATGTTTCCTTCTAAAGCTGAGG + Intergenic
968572717 4:1350489-1350511 CTTGTTCCATTAGCAGGCAGAGG - Intronic
969521628 4:7681225-7681247 TATGTTACCTTATGTGGCAGAGG + Intronic
971652312 4:29293992-29294014 AATGTGCCTTTGTAAGGCAGGGG + Intergenic
971742726 4:30540418-30540440 CCTGTTCCCATTTAAGGCTGTGG + Intergenic
972247949 4:37265841-37265863 AATGTTACCTTATATGGCAAAGG - Intronic
975262105 4:72315386-72315408 CATGTATCCTTATAAGAGAGGGG + Intronic
975624050 4:76324637-76324659 CATGTTACCTTTTAAAGCTGTGG - Intronic
975914961 4:79313624-79313646 CATGTTTCCTTATTAGGGCGTGG - Intronic
976004111 4:80407649-80407671 CAAGTTCTCTTATAAAGAAGTGG - Intronic
977806348 4:101302839-101302861 CATTTACTCTTAAAAGGCAGAGG - Intronic
980130919 4:128814981-128815003 AATGGTCCTTTATTAGGCAGTGG - Intronic
980139079 4:128894308-128894330 CATGTTGCAGTATAGGGCAGTGG - Intronic
981959014 4:150513358-150513380 AATGATGCTTTATAAGGCAGAGG + Intronic
982942359 4:161574199-161574221 AATGTTACCTTATATGGCAAAGG - Intronic
983539158 4:168890074-168890096 CCTCTTCCCTCATAGGGCAGTGG - Intronic
983572604 4:169225929-169225951 CATCTTCCCTTATCTGCCAGAGG - Intronic
986558013 5:9031042-9031064 GATGTTCCTTTATAAGAAAGTGG - Intergenic
987886898 5:23824647-23824669 CATGTATCCTTATAAGAGAGAGG - Intergenic
989490035 5:42039715-42039737 AATGTTACCTTATACGGCAAAGG + Intergenic
991122136 5:63028937-63028959 TATGTTACCTTATATGGCATAGG + Intergenic
991398204 5:66226424-66226446 AATGTTACCTTATAAGGAAAAGG - Intergenic
993007936 5:82448282-82448304 CAAGTTCCCTTATTAGACAGAGG - Intergenic
995091835 5:108187364-108187386 TATGTTACCTTATAAGGCAAAGG + Intronic
996642780 5:125777090-125777112 TATGTTACCTTATATGGCAAAGG - Intergenic
998639934 5:143997912-143997934 CATGGTCACTTAGAAGGCACTGG - Intergenic
998711531 5:144831378-144831400 CTTGTTACCTAATAAGGCACAGG - Intergenic
1002414127 5:179109894-179109916 CATGTTCTTTTAGAAGGCATGGG + Intergenic
1004055096 6:12128290-12128312 CATGTTCCTCAAAAAGGCAGAGG - Intronic
1006855198 6:37128117-37128139 CAAGTTCCCTGATCAGGCTGTGG + Intergenic
1008618159 6:53245933-53245955 TATGTTACCTTATATGGCAAAGG - Intergenic
1009349952 6:62661639-62661661 CCTGTTCCCATATAGGGCTGTGG + Intergenic
1010158467 6:72823068-72823090 TATGTTGCCTTATATGGCAAAGG - Intronic
1011100293 6:83712777-83712799 CATGTTCTCTTTGAAGGCACAGG + Intergenic
1011491879 6:87901018-87901040 CCTGTTCCCATTTAAGGCTGTGG + Intergenic
1014104271 6:117545393-117545415 CATGTTCCTTGATGAGTCAGAGG - Intronic
1015068718 6:129062527-129062549 CCTGTTTCGTTATAAAGCAGGGG + Intronic
1015165308 6:130195085-130195107 CCAGTTCCCTTATTAGGCTGAGG + Intronic
1015232035 6:130925511-130925533 CATGTTCTCTTAGTAGGCATAGG - Intronic
1015506048 6:133989761-133989783 CATGTTTCCTTATATGACATTGG + Exonic
1017503630 6:155047622-155047644 CACTTTCCCTTCTAAGGCAGGGG + Intronic
1018087647 6:160318683-160318705 CATGTTGTCTTATAGGGTAGAGG - Intergenic
1021488249 7:21190321-21190343 CTTGTTCCCTTATGATGCATGGG - Intergenic
1021903388 7:25310046-25310068 CATACTCCATTATAGGGCAGTGG + Intergenic
1023225988 7:37969578-37969600 CATGTTCCCTCCTATCGCAGAGG - Intronic
1026774955 7:73225725-73225747 AATGTTCCCTATTGAGGCAGGGG + Intergenic
1027015810 7:74779096-74779118 AATGTTCCCTATTGAGGCAGGGG + Exonic
1027072219 7:75166841-75166863 AATGTTCCCTATTGAGGCAGGGG - Intergenic
1027757108 7:82228042-82228064 CATGTTACATTATATGGCAACGG + Intronic
1028800613 7:94961157-94961179 CTTGTTTTCTTATAAAGCAGAGG - Intronic
1030168126 7:106574818-106574840 TATGTTACCTTATACGGCAAAGG + Intergenic
1030795779 7:113785583-113785605 AATGTTACTTTCTAAGGCAGGGG + Intergenic
1033772062 7:144563898-144563920 CATGTTCCCTTATAAGGCAGAGG - Intronic
1034479511 7:151308623-151308645 CTAGTTCCATTATGAGGCAGGGG + Intergenic
1036775158 8:11606620-11606642 CCTGATCCCCTATAAGGAAGAGG + Intergenic
1037469479 8:19193492-19193514 CAAGTGTCCTTATAAGGCTGAGG - Intergenic
1037872431 8:22510810-22510832 CATGTTGCCTAATAACACAGTGG + Intronic
1040586435 8:48747543-48747565 CATCTTCCCATATAACTCAGAGG - Intergenic
1042947738 8:74171872-74171894 CAAGTGCCTTTTTAAGGCAGAGG + Intergenic
1044028465 8:87204077-87204099 CATGTTCCCTTTGAAGGATGAGG + Intronic
1044330416 8:90913749-90913771 GATGTTCCTTTGGAAGGCAGTGG - Intronic
1044429993 8:92096839-92096861 ATGGTTCCCTTAAAAGGCAGGGG - Intronic
1047596625 8:126384173-126384195 CATGTTCCCTTTAAAAGCAAAGG - Intergenic
1050414940 9:5406527-5406549 CATGTTCTCTTATAAGTGGGAGG + Intronic
1051346098 9:16152551-16152573 CTTATTCCTTTTTAAGGCAGTGG - Intergenic
1051780660 9:20684786-20684808 CATGTCCACTTATAATGCAAAGG + Intronic
1052489916 9:29152568-29152590 CATTTTCACTTATAAGTGAGAGG + Intergenic
1056555759 9:87685906-87685928 CATCTTCCCTTTTAATGAAGAGG - Intronic
1057210877 9:93200403-93200425 CATGTTCCCTCAAGAGCCAGCGG + Intronic
1058617824 9:106852590-106852612 CATAACCCCTTATCAGGCAGAGG - Intergenic
1059123621 9:111663153-111663175 CAGGTTTTCTTCTAAGGCAGAGG + Intronic
1186890964 X:13958780-13958802 TATGTTGCCTTATATGGCAAAGG - Intergenic
1188352852 X:29153318-29153340 TATATTACCTTATAAGGCAAAGG - Intronic
1190823116 X:53993053-53993075 CATGTTCCCTTAAAAAAGAGGGG + Intronic
1191755555 X:64588634-64588656 AATGTTACCTTATATGGCAAAGG - Intergenic
1196941413 X:120779985-120780007 CATGTTTCCATTTAAGGCCGAGG - Intergenic
1197053258 X:122086612-122086634 CATGAGCTCTAATAAGGCAGAGG + Intergenic
1199898387 X:152148593-152148615 CCTGTTCAATGATAAGGCAGCGG - Intergenic