ID: 1033778589

View in Genome Browser
Species Human (GRCh38)
Location 7:144642822-144642844
Sequence CAGTGTCCCCATCTGTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033778585_1033778589 -3 Left 1033778585 7:144642802-144642824 CCTCCCCACTATTTGAGAATCAG 0: 1
1: 0
2: 1
3: 4
4: 111
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778588_1033778589 -8 Left 1033778588 7:144642807-144642829 CCACTATTTGAGAATCAGTGTCC 0: 1
1: 0
2: 3
3: 20
4: 289
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778580_1033778589 10 Left 1033778580 7:144642789-144642811 CCCAATAACCCGCCCTCCCCACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778582_1033778589 2 Left 1033778582 7:144642797-144642819 CCCGCCCTCCCCACTATTTGAGA 0: 1
1: 0
2: 0
3: 28
4: 268
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778579_1033778589 16 Left 1033778579 7:144642783-144642805 CCTTCTCCCAATAACCCGCCCTC 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778583_1033778589 1 Left 1033778583 7:144642798-144642820 CCGCCCTCCCCACTATTTGAGAA 0: 1
1: 0
2: 6
3: 21
4: 248
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778586_1033778589 -6 Left 1033778586 7:144642805-144642827 CCCCACTATTTGAGAATCAGTGT 0: 1
1: 0
2: 1
3: 12
4: 180
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778581_1033778589 9 Left 1033778581 7:144642790-144642812 CCAATAACCCGCCCTCCCCACTA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778578_1033778589 17 Left 1033778578 7:144642782-144642804 CCCTTCTCCCAATAACCCGCCCT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778584_1033778589 -2 Left 1033778584 7:144642801-144642823 CCCTCCCCACTATTTGAGAATCA 0: 1
1: 0
2: 2
3: 14
4: 191
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data
1033778587_1033778589 -7 Left 1033778587 7:144642806-144642828 CCCACTATTTGAGAATCAGTGTC 0: 1
1: 0
2: 1
3: 4
4: 166
Right 1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033778589 Original CRISPR CAGTGTCCCCATCTGTAAGT TGG Intronic
No off target data available for this crispr