ID: 1033781884

View in Genome Browser
Species Human (GRCh38)
Location 7:144680705-144680727
Sequence CAGTCAAACTAGTTGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033781884_1033781890 9 Left 1033781884 7:144680705-144680727 CCTGAATCCAACTAGTTTGACTG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1033781890 7:144680737-144680759 TGTATTTAGAGGTTGATTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 200
1033781884_1033781889 -2 Left 1033781884 7:144680705-144680727 CCTGAATCCAACTAGTTTGACTG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1033781889 7:144680726-144680748 TGGTTAGGGTTTGTATTTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033781884 Original CRISPR CAGTCAAACTAGTTGGATTC AGG (reversed) Intronic
901147929 1:7080279-7080301 CTCTCAAAATAGGTGGATTCAGG + Intronic
903337119 1:22632612-22632634 CAGTCAAAGAAGATGGATACTGG + Intergenic
910522458 1:88138117-88138139 CAGTCAAACTACCTGATTTCTGG - Intergenic
911201075 1:95044160-95044182 AAGGGAAAATAGTTGGATTCTGG - Intronic
912208293 1:107532386-107532408 AAGGCAAACAAGTTGGATCCTGG + Intergenic
913182698 1:116337393-116337415 AATTCAACCTAGGTGGATTCAGG - Intergenic
915128509 1:153681507-153681529 CTGTCTACCTAGTAGGATTCAGG + Intronic
918053919 1:181001949-181001971 CAGGCAAACTACTTGAGTTCAGG + Intronic
918337467 1:183533009-183533031 CAGTCAAAATACTGGGATTGAGG + Intronic
918564076 1:185905803-185905825 AACTCTAACAAGTTGGATTCTGG - Intronic
918857196 1:189772210-189772232 CAATCAACCCAGTTGGAATCAGG - Intergenic
920132135 1:203740550-203740572 CAAAGAAACTGGTTGGATTCTGG - Exonic
1063890567 10:10623914-10623936 CAGTCAGACTACCTGGGTTCCGG - Intergenic
1065153992 10:22851106-22851128 CACTCAATCTGGTTGGATCCTGG - Intergenic
1066086447 10:31976538-31976560 GAGTGAGACTAGTTTGATTCTGG - Intergenic
1068860249 10:61840694-61840716 CCTTCAAAATAGTTAGATTCAGG + Intergenic
1069004629 10:63303745-63303767 CATACAAACTATTTGGATACAGG + Intronic
1069100295 10:64311536-64311558 CTGTCAAACCAGCTGGCTTCAGG + Intergenic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1075219947 10:120576232-120576254 CATTCAAAGAAGCTGGATTCAGG - Intronic
1086013008 11:82128239-82128261 CAATCAACCTGGTTAGATTCAGG + Intergenic
1086536214 11:87849906-87849928 AGCTCAAACTAGTTGTATTCTGG + Intergenic
1089957810 11:122588615-122588637 CAATCAAACCAGTTGGGCTCAGG + Intergenic
1090618791 11:128542486-128542508 CACTGAAGCTAGTTTGATTCAGG + Intronic
1092968012 12:13663752-13663774 CACACAAACTAGTTGGGTTTTGG - Intronic
1096419436 12:51444208-51444230 CAGTCCATCTAACTGGATTCTGG - Intronic
1096438533 12:51617747-51617769 CAGGCAATCCAGTTAGATTCAGG + Intronic
1096810100 12:54163958-54163980 CAGTTATACTGCTTGGATTCAGG - Intergenic
1098682725 12:73378413-73378435 CAGTCAAACTTCTTCCATTCTGG + Intergenic
1107204707 13:37769722-37769744 GAGACAAACTTGTTGCATTCTGG - Intronic
1113389625 13:109882929-109882951 CAGACATACAAGTTGTATTCTGG + Intergenic
1115900912 14:38147104-38147126 CAGTCGAACTAGTGGGCTACAGG + Intergenic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1123047228 14:105524868-105524890 CAATCAACCTAGTTGGTTTCAGG + Intergenic
1133571854 16:7048879-7048901 CAATCAATCTTGTTGCATTCAGG + Intronic
1133701152 16:8310385-8310407 AAGTCAAACTTGTTGCATTGTGG + Intergenic
1134378794 16:13704599-13704621 CAGTTAACCCAGGTGGATTCAGG - Intergenic
1135594886 16:23734328-23734350 CAGTCAGAATAGTTCTATTCTGG + Intergenic
1141327211 16:83072574-83072596 AAGTCAGAACAGTTGGATTCTGG + Intronic
1141931104 16:87203464-87203486 CAATCAAGGTGGTTGGATTCAGG - Intronic
1145922952 17:28624938-28624960 CAGGCAGACTAGTCTGATTCTGG - Intronic
1154054330 18:10997217-10997239 CAGTCAATCTGGTTGGTCTCAGG - Intronic
1156237011 18:35215576-35215598 CATTAAAACTAGAAGGATTCTGG - Intergenic
1157907533 18:51583093-51583115 CATTCAAACTTGTTGCATGCAGG + Intergenic
926009392 2:9396270-9396292 CAGTCAACCTAGTTGATCTCAGG - Intronic
928008851 2:27588098-27588120 CAGACAAACGAGTTGTATTCAGG - Intronic
931690996 2:64834780-64834802 CATTTAAGCTAGTTGGAGTCAGG - Intergenic
932395414 2:71443664-71443686 AAGTTAAAATAATTGGATTCTGG + Intergenic
933889216 2:86751170-86751192 CAATCAACCTTGTTGGATTCAGG + Intronic
935525210 2:104157297-104157319 CATTCAATCTAGTTAGAGTCCGG - Intergenic
935621219 2:105131408-105131430 CAGTTAAACTGGTTGGATCCTGG - Intergenic
943930086 2:193838180-193838202 GAGTCAGACTATTTGGGTTCAGG - Intergenic
946038262 2:216761896-216761918 CAGTGAAATTAATGGGATTCAGG + Intergenic
1170594568 20:17795274-17795296 AATTCTAACTTGTTGGATTCTGG - Intergenic
1175028663 20:55930500-55930522 AAGTCAAACTCCTTGGATTTTGG - Intergenic
1177443664 21:21163377-21163399 CAGACAAACTAGCTGTACTCTGG - Intronic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
955768047 3:62365375-62365397 CTGACAAACTGCTTGGATTCAGG - Intergenic
956004037 3:64760273-64760295 TAGTCAAAATAGGTGGATGCAGG - Intergenic
957872592 3:86108343-86108365 CAATCAAACTAGGAGGAGTCAGG + Intergenic
959351755 3:105274203-105274225 CAATCAAACTAGTTAGATTCAGG + Intergenic
959641631 3:108644400-108644422 AAGTCAAACTGTTTGGATTGCGG - Exonic
960714792 3:120564265-120564287 CAGTGAAAATAATTGGATTTGGG + Intergenic
963406355 3:144868518-144868540 CTGTAAAACTACTTGGATTTTGG + Intergenic
974611775 4:64227554-64227576 CAGTTAAACTTGATGCATTCTGG + Intergenic
981634924 4:146865795-146865817 CAGGCCAACTAGTTTGATTGGGG + Intronic
981971507 4:150667767-150667789 CAGTCAGCATGGTTGGATTCTGG - Intronic
982031356 4:151304317-151304339 CAGAAAAACTAGCTGGATTGTGG + Intronic
986614420 5:9601838-9601860 CTGTAACACTAGTTGGAGTCTGG - Intergenic
988179870 5:27776538-27776560 CATTCCAACTATTTGGATTTAGG - Intergenic
990799009 5:59578555-59578577 CAGTCAAACAAGTTGGAAAAAGG - Intronic
991235135 5:64385052-64385074 CAGTCAACCTGCTTAGATTCAGG - Intergenic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993002751 5:82398408-82398430 AAACCAAACTAGTTTGATTCAGG - Intergenic
993192123 5:84696190-84696212 CACTGAGACTAGTTGGCTTCAGG + Intergenic
997175197 5:131768431-131768453 CAGTTAAACAACTTGGATACTGG - Intronic
998886199 5:146696687-146696709 GAATCAAACTACTTGGAGTCTGG + Intronic
999377807 5:151098980-151099002 CAGTTAAGGTAGTTGCATTCTGG - Intergenic
1001195221 5:169667052-169667074 CAGGCAAACTCCTTGGATCCAGG + Intronic
1001343025 5:170864490-170864512 CATTCAAAGCAGTTGCATTCTGG + Intronic
1005273262 6:24188900-24188922 CCGTTAATCTAGTTGCATTCTGG - Intronic
1008488782 6:52063879-52063901 CTGTCAAACCAGCTGCATTCAGG + Intronic
1009287439 6:61838676-61838698 GGGTCAAAATAGATGGATTCAGG - Intronic
1014966290 6:127756754-127756776 CTGGCAAACTAGTTGCATTTTGG - Intronic
1018302889 6:162422496-162422518 CAGTCAAACCTGCTGTATTCTGG - Intronic
1021514989 7:21474527-21474549 CAGTAAAACTAGATGGCTTAAGG - Intronic
1022622312 7:31997386-31997408 CACTCACAATGGTTGGATTCAGG + Intronic
1025024860 7:55507994-55508016 AACCCAAACTAGTTGCATTCAGG + Intronic
1032546588 7:132748871-132748893 TAGTGAAAATAGTAGGATTCTGG - Intergenic
1033781884 7:144680705-144680727 CAGTCAAACTAGTTGGATTCAGG - Intronic
1039230061 8:35435826-35435848 CAGTCAACCTCTTTGAATTCTGG + Intronic
1040834297 8:51716429-51716451 CAGTCAAGCTAGTTGAAGTGAGG + Intronic
1043084579 8:75812907-75812929 AATTCAAACTAGTAAGATTCTGG + Intergenic
1044371667 8:91419398-91419420 CAGCCAAATGAGTTGGTTTCAGG + Intergenic
1045567614 8:103337627-103337649 CAGTGAAACTAATTAGATCCTGG - Intergenic
1045656329 8:104391037-104391059 CAGTCAAAATAGGTGGTTTAAGG - Intronic
1048407852 8:134141284-134141306 TAGTTAAACAAGTTGGATTAAGG + Intergenic
1054458529 9:65449657-65449679 CAGTCAAATTAGATGCCTTCAGG - Intergenic
1055474537 9:76648580-76648602 GAGTCCAACTACATGGATTCTGG + Intronic
1059911895 9:119053773-119053795 GAGTCAAACCAGTTGGATTGGGG + Intergenic
1187241042 X:17513569-17513591 CTCTCAAAATAGTTTGATTCAGG - Intronic
1190926494 X:54910627-54910649 CAATCAACCCAGTTAGATTCTGG + Intergenic
1193088387 X:77468078-77468100 CTGTGAAACTCGCTGGATTCAGG + Intergenic
1201953858 Y:19598915-19598937 CCATCAAACTATTTGGCTTCTGG + Intergenic