ID: 1033783933

View in Genome Browser
Species Human (GRCh38)
Location 7:144706968-144706990
Sequence TACTAGCGAAAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033783923_1033783933 9 Left 1033783923 7:144706936-144706958 CCTTGAAACTCACTGCTAAGCCC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1033783922_1033783933 26 Left 1033783922 7:144706919-144706941 CCACAGGGAGGTGACAGCCTTGA 0: 1
1: 0
2: 6
3: 34
4: 256
Right 1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033783933 Original CRISPR TACTAGCGAAAGCAGGTGGA GGG Intronic
906559170 1:46742359-46742381 AGCGAGCTAAAGCAGGTGGAAGG + Intergenic
909708651 1:78617933-78617955 TACTGGGGAAAGCTGGTGGGAGG - Intergenic
910060965 1:83091283-83091305 TACTATTGAAGGAAGGTGGATGG + Intergenic
914915525 1:151816804-151816826 CCCTGGGGAAAGCAGGTGGAGGG + Exonic
916194839 1:162213044-162213066 GTCTAGGAAAAGCAGGTGGAGGG + Intronic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
918551798 1:185750988-185751010 TACTACAGAAAGTAGGAGGAAGG - Intronic
919677517 1:200398595-200398617 TACTAGCAAGAGCAGATGGTGGG - Intergenic
921231703 1:213079814-213079836 TAGAAGCAAAAGTAGGTGGAGGG - Intronic
921273850 1:213497679-213497701 TCCCAAAGAAAGCAGGTGGAGGG + Intergenic
1063594801 10:7424550-7424572 TACTAGACAAAGCAGCTGGAGGG - Intergenic
1070184915 10:74052186-74052208 GACTAGCTAAAGCAGGTCCAGGG - Intronic
1072152738 10:92696373-92696395 TACCCGGGAAAGCAGGTGGGAGG - Intergenic
1073881764 10:107989761-107989783 TACTAGAGAGGGCAGGGGGAAGG + Intergenic
1078722605 11:13898169-13898191 TCCTTGCCAAAGCAGGTGGAAGG + Intergenic
1090972153 11:131653267-131653289 TAAGAGAGACAGCAGGTGGAGGG - Intronic
1091680452 12:2523089-2523111 TAATATGCAAAGCAGGTGGACGG + Intronic
1094591446 12:31825128-31825150 TACTTACCAAAGCAGGTGAAAGG - Intergenic
1094675306 12:32614023-32614045 TCCTAGCAAAAGGATGTGGATGG - Intronic
1096093943 12:48922126-48922148 TACTGGCTAAAGCTGGTGAAGGG - Exonic
1096102910 12:48980249-48980271 TAGTAGAGAAAGCAGGTGCGTGG - Intronic
1096536089 12:52275737-52275759 CACTGGTGACAGCAGGTGGATGG + Intronic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1107020176 13:35743204-35743226 TACTAGTGAGAACAAGTGGATGG + Intergenic
1107613387 13:42139579-42139601 TACTAGAGGCAGCAGGTTGAAGG - Intronic
1113340783 13:109423336-109423358 CACTAGCAAACGCAGGTGAAAGG + Intergenic
1121147343 14:91595856-91595878 TTCTAGAGAAATCAGGTAGAGGG + Intronic
1128659216 15:69485486-69485508 CCCAACCGAAAGCAGGTGGAAGG - Intergenic
1138551453 16:57751052-57751074 TCCTAGGGAAAGCGGGTGGCAGG + Intronic
1143711262 17:8736764-8736786 AGCTAGCAAAAGCAGGTGTAGGG + Intronic
1144802736 17:17941878-17941900 TACTAGGGAGGGAAGGTGGAAGG + Intronic
1146235197 17:31153576-31153598 TGCAAGAGAAAGCAGGTGGAAGG - Intronic
1147547200 17:41411259-41411281 TATTTGCAAAAGCAGGTGGTGGG + Intergenic
1153205905 18:2700575-2700597 TACTTGAGAAAGCAGCTAGAGGG + Exonic
1153499028 18:5729638-5729660 TACTAGAAAGAGGAGGTGGAGGG - Intergenic
1153509239 18:5834091-5834113 TTCTATACAAAGCAGGTGGAGGG + Intergenic
1153740408 18:8120167-8120189 TATTTGCAAAAGCAGGTGGTAGG + Intronic
1160900661 19:1426466-1426488 TACTACCGAGAGCATGTGGCTGG - Intronic
1163132829 19:15286383-15286405 TAATAGGGACATCAGGTGGAGGG + Intronic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1164907480 19:31978880-31978902 TGGTGGAGAAAGCAGGTGGAAGG - Intergenic
925475287 2:4206447-4206469 GACTAGCTAAAACAGGTCGAAGG - Intergenic
925903183 2:8523088-8523110 TACCAGCGAAAGCAGATGCATGG + Intergenic
933542246 2:83661580-83661602 TACTTGTTAAAGCAGTTGGAGGG - Intergenic
940401960 2:153257711-153257733 TTCTAGAGAAAGCAGGTCAAAGG - Intergenic
948125303 2:235560642-235560664 TACCAGCCAAAGAATGTGGATGG + Intronic
1169800797 20:9509339-9509361 TAGTAGCGACAACATGTGGAAGG - Intergenic
1176096934 20:63348644-63348666 TGCCGGCGACAGCAGGTGGATGG + Intronic
1179351178 21:40612404-40612426 TGCTAGAGATAGCATGTGGATGG + Intronic
953440465 3:42911711-42911733 TTCTAGCGAAAGCAGAAGTAAGG + Intronic
958951676 3:100423887-100423909 TACTAGGGAAAGCAGGTATCTGG + Intronic
958959017 3:100491834-100491856 AACTTGGGAAAGCAGTTGGAGGG - Intergenic
964531866 3:157677054-157677076 TACTGACAAAAGCAGGAGGAAGG + Intronic
964889893 3:161521611-161521633 TACTTGTGAAAGCACCTGGAAGG - Intergenic
965909681 3:173757559-173757581 TTATAGCCAAAGAAGGTGGATGG + Intronic
966811975 3:183855102-183855124 CCCTAGAGAAAGCAGGTTGATGG + Intronic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970409863 4:15794208-15794230 TACTTGCCTAAGCAAGTGGATGG + Intronic
971369537 4:26005396-26005418 GAATAGGGAAAGCAGCTGGAAGG - Intergenic
971902138 4:32674350-32674372 TAGTAGCGATAACAGGTAGATGG + Intergenic
972336508 4:38111672-38111694 TAGTAGGAAAAGCAGGGGGAGGG + Intronic
984207687 4:176805833-176805855 AGCTAGCAAAAGGAGGTGGAGGG - Intergenic
987916816 5:24226080-24226102 TACTAGAGAAAGAATTTGGAAGG - Intergenic
992385619 5:76281685-76281707 AACTAGGGAATGCAGGTGGCTGG - Intronic
995753793 5:115480301-115480323 TAGTAGCAGAAGCAGGAGGAAGG - Intergenic
996798582 5:127377849-127377871 TACTTTCGAAATCAGGTTGATGG + Intronic
999740039 5:154542936-154542958 AACTAGGGATACCAGGTGGAAGG - Intergenic
1001200305 5:169709987-169710009 TTTTAGCCAAAGCAGGTGGGAGG + Intronic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1011922352 6:92595311-92595333 TACTATCCAAAGCAAGTGGGTGG - Intergenic
1013755247 6:113454038-113454060 TACATGTGAAAGCAGGTGGCTGG - Intergenic
1014498975 6:122163153-122163175 GGCTAGGAAAAGCAGGTGGAAGG - Intergenic
1023617209 7:42031702-42031724 TACTAACCAGAGCAGGTGTATGG + Intronic
1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG + Intronic
1033811883 7:145023861-145023883 CACTTGCAAAAGCAGGTGGTGGG - Intergenic
1037121320 8:15290563-15290585 CACTAGCCACAGCTGGTGGAGGG - Intergenic
1042735493 8:71983349-71983371 TGCTAGAGGAAGCAGTTGGATGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1051632821 9:19156123-19156145 TATTTGCAAAAGCAGGTGGCAGG - Intergenic
1052774970 9:32724020-32724042 TACACGAGAAAGCAGGTGGGAGG + Intergenic
1055485893 9:76756071-76756093 TAGTAGCCAAAGCTGGTGGTTGG - Intronic
1056300643 9:85237137-85237159 TAGTAGCCAAAGCAGGCTGAGGG - Intergenic
1056443030 9:86639275-86639297 TACTTGCAAAAGCAGATGGCAGG - Intergenic
1059779487 9:117511235-117511257 TAGTGGCAAAAGCAGGTGAATGG - Intergenic
1185523464 X:759198-759220 GACTAGCTAAAGCAGGTCTAGGG + Intergenic
1185814682 X:3143931-3143953 TACTTGGAAAGGCAGGTGGAGGG + Intergenic
1187265708 X:17731071-17731093 TACCAGAGAAAGCAAGTGGATGG - Intronic
1187750945 X:22464189-22464211 TACTGGAGAAACCACGTGGAAGG + Intergenic
1189144557 X:38642679-38642701 TACAAGAGTAAGCAGCTGGAGGG + Intronic
1189308381 X:40004254-40004276 TAGTAGCGGAACCAGATGGAAGG + Intergenic
1189415026 X:40805601-40805623 CACTAGGGAGAGCATGTGGACGG + Intergenic
1191927290 X:66327246-66327268 TACCAGGGAAAGGATGTGGATGG + Intergenic
1192838499 X:74828113-74828135 GAGTAGAGAAAGAAGGTGGATGG + Intronic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1198077138 X:133204545-133204567 AACAATGGAAAGCAGGTGGAGGG + Intergenic